FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638443_at:

>probe:Drosophila_2:1638443_at:431:159; Interrogation_Position=362; Antisense; ACAAGTTTGTTGACTTTCCGCGTGA
>probe:Drosophila_2:1638443_at:403:329; Interrogation_Position=381; Antisense; GCGTGACCTGTGCAATTGTCAGCGA
>probe:Drosophila_2:1638443_at:224:355; Interrogation_Position=418; Antisense; GCACTGGCCTGCGATCAGCGGTTGA
>probe:Drosophila_2:1638443_at:430:649; Interrogation_Position=432; Antisense; TCAGCGGTTGACCTTGGGCCACAAG
>probe:Drosophila_2:1638443_at:211:557; Interrogation_Position=456; Antisense; GGACGATCCCTACTGGATGCGCGAA
>probe:Drosophila_2:1638443_at:338:49; Interrogation_Position=472; Antisense; ATGCGCGAACGGTGCCAGACGAAGT
>probe:Drosophila_2:1638443_at:310:87; Interrogation_Position=535; Antisense; AGTGCGCGCTGCAATCGGGCCAAGT
>probe:Drosophila_2:1638443_at:592:247; Interrogation_Position=606; Antisense; CAAGACGACGGGTGTGGCCACCGAA
>probe:Drosophila_2:1638443_at:721:173; Interrogation_Position=630; Antisense; AAAGCGGCGTCGAAAGCGCACCATA
>probe:Drosophila_2:1638443_at:444:75; Interrogation_Position=669; Antisense; AGGACGAACGGCATTGCATCCCAAT
>probe:Drosophila_2:1638443_at:382:57; Interrogation_Position=692; Antisense; ATGAGCTGACCAAGCCGATTCCATC
>probe:Drosophila_2:1638443_at:723:5; Interrogation_Position=709; Antisense; ATTCCATCGTCGGAGAAACCGGCGG
>probe:Drosophila_2:1638443_at:666:651; Interrogation_Position=891; Antisense; TCAAATTCATTGTAACCGCAGGTTT
>probe:Drosophila_2:1638443_at:208:223; Interrogation_Position=929; Antisense; AAGGGCAGCACGATTGCACTCAACA

Paste this into a BLAST search page for me
ACAAGTTTGTTGACTTTCCGCGTGAGCGTGACCTGTGCAATTGTCAGCGAGCACTGGCCTGCGATCAGCGGTTGATCAGCGGTTGACCTTGGGCCACAAGGGACGATCCCTACTGGATGCGCGAAATGCGCGAACGGTGCCAGACGAAGTAGTGCGCGCTGCAATCGGGCCAAGTCAAGACGACGGGTGTGGCCACCGAAAAAGCGGCGTCGAAAGCGCACCATAAGGACGAACGGCATTGCATCCCAATATGAGCTGACCAAGCCGATTCCATCATTCCATCGTCGGAGAAACCGGCGGTCAAATTCATTGTAACCGCAGGTTTAAGGGCAGCACGATTGCACTCAACA

Full Affymetrix probeset data:

Annotations for 1638443_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720