FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638448_at:

>probe:Drosophila_2:1638448_at:126:601; Interrogation_Position=152; Antisense; TGTAGTTGACACACCACTTAGCCCC
>probe:Drosophila_2:1638448_at:716:177; Interrogation_Position=193; Antisense; AAACATGAGTTGGTCGGGTTCCAGT
>probe:Drosophila_2:1638448_at:315:707; Interrogation_Position=234; Antisense; TTGAGCAGCTGAAAAAGTCCGTGGA
>probe:Drosophila_2:1638448_at:309:503; Interrogation_Position=250; Antisense; GTCCGTGGAGTCGATCGTGGCCAAA
>probe:Drosophila_2:1638448_at:633:181; Interrogation_Position=272; Antisense; AAAACTGGGCCCAGCAGCAAGTTCT
>probe:Drosophila_2:1638448_at:290:351; Interrogation_Position=285; Antisense; GCAGCAAGTTCTCCAAGGATCTCGT
>probe:Drosophila_2:1638448_at:359:251; Interrogation_Position=298; Antisense; CAAGGATCTCGTCCAGCGGATCGGC
>probe:Drosophila_2:1638448_at:629:177; Interrogation_Position=354; Antisense; AAACGGATCGGCATGTGTTTCTCGC
>probe:Drosophila_2:1638448_at:44:217; Interrogation_Position=392; Antisense; AAGTTCCAGCAGACGATTGGCAGAA
>probe:Drosophila_2:1638448_at:94:417; Interrogation_Position=422; Antisense; GAGCGAATAGTGCAGCACGCCCATT
>probe:Drosophila_2:1638448_at:727:153; Interrogation_Position=451; Antisense; ACAGACCTACTCCAGTTCCATAGTG
>probe:Drosophila_2:1638448_at:111:471; Interrogation_Position=465; Antisense; GTTCCATAGTGTCGGCAGTGATCTT
>probe:Drosophila_2:1638448_at:91:85; Interrogation_Position=481; Antisense; AGTGATCTTTCTCTTGGTCTCCATA
>probe:Drosophila_2:1638448_at:560:729; Interrogation_Position=494; Antisense; TTGGTCTCCATATTCGCTCTCTTTG

Paste this into a BLAST search page for me
TGTAGTTGACACACCACTTAGCCCCAAACATGAGTTGGTCGGGTTCCAGTTTGAGCAGCTGAAAAAGTCCGTGGAGTCCGTGGAGTCGATCGTGGCCAAAAAAACTGGGCCCAGCAGCAAGTTCTGCAGCAAGTTCTCCAAGGATCTCGTCAAGGATCTCGTCCAGCGGATCGGCAAACGGATCGGCATGTGTTTCTCGCAAGTTCCAGCAGACGATTGGCAGAAGAGCGAATAGTGCAGCACGCCCATTACAGACCTACTCCAGTTCCATAGTGGTTCCATAGTGTCGGCAGTGATCTTAGTGATCTTTCTCTTGGTCTCCATATTGGTCTCCATATTCGCTCTCTTTG

Full Affymetrix probeset data:

Annotations for 1638448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720