FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638449_at:

>probe:Drosophila_2:1638449_at:517:13; Interrogation_Position=178; Antisense; ATTCACAGCCTCAATACGGTCCAGA
>probe:Drosophila_2:1638449_at:451:241; Interrogation_Position=190; Antisense; AATACGGTCCAGAGCCAGCACCGAT
>probe:Drosophila_2:1638449_at:12:37; Interrogation_Position=230; Antisense; ATCATCACATTCTAGCCACGGCAAC
>probe:Drosophila_2:1638449_at:338:197; Interrogation_Position=258; Antisense; AACGGCGACTGCAACAGCGGCGGCA
>probe:Drosophila_2:1638449_at:380:607; Interrogation_Position=497; Antisense; TGATGACCCATCAGCAGCACTCTGT
>probe:Drosophila_2:1638449_at:650:351; Interrogation_Position=510; Antisense; GCAGCACTCTGTGGCGCAGCAGCAA
>probe:Drosophila_2:1638449_at:259:115; Interrogation_Position=614; Antisense; AGCAGTTGTCGCTGCATCAGAACCA
>probe:Drosophila_2:1638449_at:319:33; Interrogation_Position=629; Antisense; ATCAGAACCACCTGTACTTCAGCGG
>probe:Drosophila_2:1638449_at:430:667; Interrogation_Position=643; Antisense; TACTTCAGCGGTGCCAGTTTGGGTC
>probe:Drosophila_2:1638449_at:514:297; Interrogation_Position=682; Antisense; CGCCAGATCTTCAGTCATCTGCAGA
>probe:Drosophila_2:1638449_at:226:649; Interrogation_Position=692; Antisense; TCAGTCATCTGCAGAGTGCTCTTAT
>probe:Drosophila_2:1638449_at:513:507; Interrogation_Position=707; Antisense; GTGCTCTTATGCCTCTGAGTGTTAG
>probe:Drosophila_2:1638449_at:337:283; Interrogation_Position=721; Antisense; CTGAGTGTTAGTAAGTATGACGCCT
>probe:Drosophila_2:1638449_at:207:683; Interrogation_Position=736; Antisense; TATGACGCCTTAAGACCCTTCAAAA

Paste this into a BLAST search page for me
ATTCACAGCCTCAATACGGTCCAGAAATACGGTCCAGAGCCAGCACCGATATCATCACATTCTAGCCACGGCAACAACGGCGACTGCAACAGCGGCGGCATGATGACCCATCAGCAGCACTCTGTGCAGCACTCTGTGGCGCAGCAGCAAAGCAGTTGTCGCTGCATCAGAACCAATCAGAACCACCTGTACTTCAGCGGTACTTCAGCGGTGCCAGTTTGGGTCCGCCAGATCTTCAGTCATCTGCAGATCAGTCATCTGCAGAGTGCTCTTATGTGCTCTTATGCCTCTGAGTGTTAGCTGAGTGTTAGTAAGTATGACGCCTTATGACGCCTTAAGACCCTTCAAAA

Full Affymetrix probeset data:

Annotations for 1638449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720