FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638452_at:

>probe:Drosophila_2:1638452_at:535:555; Interrogation_Position=3942; Antisense; GGACCCCAAGCACCGAAAGCTGAAG
>probe:Drosophila_2:1638452_at:238:101; Interrogation_Position=3965; Antisense; AGAGCATGAGCACATCTGAGAGCAA
>probe:Drosophila_2:1638452_at:99:103; Interrogation_Position=3983; Antisense; AGAGCAAGATCATGGAGCACCCGGA
>probe:Drosophila_2:1638452_at:660:103; Interrogation_Position=3998; Antisense; AGCACCCGGAGGAGGACCAGACACA
>probe:Drosophila_2:1638452_at:695:547; Interrogation_Position=4029; Antisense; GGATGGGTAGTAGCCACACCCGCAG
>probe:Drosophila_2:1638452_at:219:93; Interrogation_Position=4052; Antisense; AGTTGCTGCTGACCGACGTACACAA
>probe:Drosophila_2:1638452_at:606:85; Interrogation_Position=4080; Antisense; AGTGCACAATGTCGATCCCTGGGAT
>probe:Drosophila_2:1638452_at:3:445; Interrogation_Position=4102; Antisense; GATGATCCGAGCAGCAGACACCGAG
>probe:Drosophila_2:1638452_at:253:197; Interrogation_Position=4145; Antisense; AACGAGTGAGCAATTGCCTCCGGTC
>probe:Drosophila_2:1638452_at:663:471; Interrogation_Position=4235; Antisense; GTTCTTCGAATCAACGCGAACGCTT
>probe:Drosophila_2:1638452_at:466:381; Interrogation_Position=4252; Antisense; GAACGCTTCCGTGGGATGTCACCAT
>probe:Drosophila_2:1638452_at:398:443; Interrogation_Position=4266; Antisense; GATGTCACCATTCAGTATCCGAACA
>probe:Drosophila_2:1638452_at:130:309; Interrogation_Position=4330; Antisense; CCAGAACCCATGCAAGCCGAGGATA
>probe:Drosophila_2:1638452_at:256:263; Interrogation_Position=4465; Antisense; CAGCCCTAAGGTTTATATATCCGAA

Paste this into a BLAST search page for me
GGACCCCAAGCACCGAAAGCTGAAGAGAGCATGAGCACATCTGAGAGCAAAGAGCAAGATCATGGAGCACCCGGAAGCACCCGGAGGAGGACCAGACACAGGATGGGTAGTAGCCACACCCGCAGAGTTGCTGCTGACCGACGTACACAAAGTGCACAATGTCGATCCCTGGGATGATGATCCGAGCAGCAGACACCGAGAACGAGTGAGCAATTGCCTCCGGTCGTTCTTCGAATCAACGCGAACGCTTGAACGCTTCCGTGGGATGTCACCATGATGTCACCATTCAGTATCCGAACACCAGAACCCATGCAAGCCGAGGATACAGCCCTAAGGTTTATATATCCGAA

Full Affymetrix probeset data:

Annotations for 1638452_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720