FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638453_at:

>probe:Drosophila_2:1638453_at:402:549; Interrogation_Position=463; Antisense; GGAGTGTTCCTTCCTCACGAAGACA
>probe:Drosophila_2:1638453_at:470:211; Interrogation_Position=482; Antisense; AAGACACTTCGAGCGGAGGCAGCTG
>probe:Drosophila_2:1638453_at:530:323; Interrogation_Position=507; Antisense; GCGCATTGGCTGCAATCATCACTGA
>probe:Drosophila_2:1638453_at:261:455; Interrogation_Position=574; Antisense; GATACATGACAACTCCCAACAGGAC
>probe:Drosophila_2:1638453_at:470:207; Interrogation_Position=629; Antisense; AAGAATGGCGTCATCATCCGGTCGA
>probe:Drosophila_2:1638453_at:652:613; Interrogation_Position=666; Antisense; TGAAGAGGGTGCACGCCCTGATCAA
>probe:Drosophila_2:1638453_at:238:275; Interrogation_Position=709; Antisense; CTTTACCCCGCCATCTAAGATTAAT
>probe:Drosophila_2:1638453_at:567:657; Interrogation_Position=724; Antisense; TAAGATTAATCATCCGCCGTGGCTG
>probe:Drosophila_2:1638453_at:466:511; Interrogation_Position=759; Antisense; GTGATCGGATTACATGCAGCTCAAA
>probe:Drosophila_2:1638453_at:119:127; Interrogation_Position=817; Antisense; ACCAAAGTGCATACTCGTAGGCTGA
>probe:Drosophila_2:1638453_at:380:485; Interrogation_Position=833; Antisense; GTAGGCTGAGACGTCGAGACCGCAA
>probe:Drosophila_2:1638453_at:530:423; Interrogation_Position=848; Antisense; GAGACCGCAACTGAGACTATACTTT
>probe:Drosophila_2:1638453_at:667:675; Interrogation_Position=887; Antisense; TAGCTAATTCGTAGACGGCAGCCAT
>probe:Drosophila_2:1638453_at:304:431; Interrogation_Position=942; Antisense; GAGTCAGGTCGCCAAGTTGTAATCT

Paste this into a BLAST search page for me
GGAGTGTTCCTTCCTCACGAAGACAAAGACACTTCGAGCGGAGGCAGCTGGCGCATTGGCTGCAATCATCACTGAGATACATGACAACTCCCAACAGGACAAGAATGGCGTCATCATCCGGTCGATGAAGAGGGTGCACGCCCTGATCAACTTTACCCCGCCATCTAAGATTAATTAAGATTAATCATCCGCCGTGGCTGGTGATCGGATTACATGCAGCTCAAAACCAAAGTGCATACTCGTAGGCTGAGTAGGCTGAGACGTCGAGACCGCAAGAGACCGCAACTGAGACTATACTTTTAGCTAATTCGTAGACGGCAGCCATGAGTCAGGTCGCCAAGTTGTAATCT

Full Affymetrix probeset data:

Annotations for 1638453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720