FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638456_at:

>probe:Drosophila_2:1638456_at:142:115; Interrogation_Position=1451; Antisense; AGCAGAGACTGTCCGCCAAGAGGCA
>probe:Drosophila_2:1638456_at:245:439; Interrogation_Position=1477; Antisense; GAGGCGAGTGCTGCCGTTCATCTAA
>probe:Drosophila_2:1638456_at:419:473; Interrogation_Position=1492; Antisense; GTTCATCTAATGCAGGCCACGTACA
>probe:Drosophila_2:1638456_at:147:605; Interrogation_Position=1553; Antisense; TGATTGTCACACGAGCTGTCTACGG
>probe:Drosophila_2:1638456_at:1:409; Interrogation_Position=1624; Antisense; GACGTCACCGTAGCCATTCAATGCA
>probe:Drosophila_2:1638456_at:32:109; Interrogation_Position=1655; Antisense; AGAACGGGACCCTGCAGCTGCATGA
>probe:Drosophila_2:1638456_at:45:605; Interrogation_Position=1677; Antisense; TGATTCATCAAAGAGCGACCTGCCC
>probe:Drosophila_2:1638456_at:446:681; Interrogation_Position=1708; Antisense; TATGATCCGGGCATCGGCGAAGACA
>probe:Drosophila_2:1638456_at:505:653; Interrogation_Position=1784; Antisense; TCAAGGACAACGAGGCGCTGCGACT
>probe:Drosophila_2:1638456_at:374:669; Interrogation_Position=1845; Antisense; TACTGCTCTGCACGACAATTAGTTT
>probe:Drosophila_2:1638456_at:484:61; Interrogation_Position=1910; Antisense; AGAAAAGACCCATTCCCAGGACTTG
>probe:Drosophila_2:1638456_at:237:497; Interrogation_Position=1944; Antisense; GTCAGATCGTATATTTCCCCAGTTT
>probe:Drosophila_2:1638456_at:611:241; Interrogation_Position=1971; Antisense; AATACCACTCTGTAACTCGCTATTT
>probe:Drosophila_2:1638456_at:116:457; Interrogation_Position=2000; Antisense; GATACTTACGAGATCCGAACAGCGC

Paste this into a BLAST search page for me
AGCAGAGACTGTCCGCCAAGAGGCAGAGGCGAGTGCTGCCGTTCATCTAAGTTCATCTAATGCAGGCCACGTACATGATTGTCACACGAGCTGTCTACGGGACGTCACCGTAGCCATTCAATGCAAGAACGGGACCCTGCAGCTGCATGATGATTCATCAAAGAGCGACCTGCCCTATGATCCGGGCATCGGCGAAGACATCAAGGACAACGAGGCGCTGCGACTTACTGCTCTGCACGACAATTAGTTTAGAAAAGACCCATTCCCAGGACTTGGTCAGATCGTATATTTCCCCAGTTTAATACCACTCTGTAACTCGCTATTTGATACTTACGAGATCCGAACAGCGC

Full Affymetrix probeset data:

Annotations for 1638456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720