FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638457_at:

>probe:Drosophila_2:1638457_at:718:287; Interrogation_Position=1036; Antisense; CGGCCTGTGCCGAATGATTGTGATT
>probe:Drosophila_2:1638457_at:202:5; Interrogation_Position=1052; Antisense; ATTGTGATTGCTCCTCTGTTCGGAA
>probe:Drosophila_2:1638457_at:154:601; Interrogation_Position=1068; Antisense; TGTTCGGAATCGCTCAAACGGTCTA
>probe:Drosophila_2:1638457_at:71:177; Interrogation_Position=1083; Antisense; AAACGGTCTACTATCTGGGCGTGGC
>probe:Drosophila_2:1638457_at:451:541; Interrogation_Position=1168; Antisense; GGATTGACAAGACCGAAGCATTTTA
>probe:Drosophila_2:1638457_at:480:207; Interrogation_Position=1248; Antisense; AAGCTGTCCATGAATGTAATCGTGA
>probe:Drosophila_2:1638457_at:304:235; Interrogation_Position=1265; Antisense; AATCGTGAAGTCTCTATAGTAAGCT
>probe:Drosophila_2:1638457_at:613:493; Interrogation_Position=1293; Antisense; GTAATCGAACGATGCGCCAGCCAGC
>probe:Drosophila_2:1638457_at:298:301; Interrogation_Position=1307; Antisense; CGCCAGCCAGCGAAGTTGTTAAAGT
>probe:Drosophila_2:1638457_at:284:309; Interrogation_Position=1337; Antisense; CCAATCCTCTTAAACTACTCAAACG
>probe:Drosophila_2:1638457_at:61:375; Interrogation_Position=1392; Antisense; GAAGATAACTGATGCTCCAATGACA
>probe:Drosophila_2:1638457_at:619:89; Interrogation_Position=901; Antisense; AGTTAATCCCTTCGACGTGGTCAAG
>probe:Drosophila_2:1638457_at:87:411; Interrogation_Position=925; Antisense; GACGCGTCTGCAGGCGATTAAGAAG
>probe:Drosophila_2:1638457_at:552:105; Interrogation_Position=996; Antisense; AGACACTGAAGCACGAGGGACCCAC

Paste this into a BLAST search page for me
CGGCCTGTGCCGAATGATTGTGATTATTGTGATTGCTCCTCTGTTCGGAATGTTCGGAATCGCTCAAACGGTCTAAAACGGTCTACTATCTGGGCGTGGCGGATTGACAAGACCGAAGCATTTTAAAGCTGTCCATGAATGTAATCGTGAAATCGTGAAGTCTCTATAGTAAGCTGTAATCGAACGATGCGCCAGCCAGCCGCCAGCCAGCGAAGTTGTTAAAGTCCAATCCTCTTAAACTACTCAAACGGAAGATAACTGATGCTCCAATGACAAGTTAATCCCTTCGACGTGGTCAAGGACGCGTCTGCAGGCGATTAAGAAGAGACACTGAAGCACGAGGGACCCAC

Full Affymetrix probeset data:

Annotations for 1638457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720