Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638462_at:

>probe:Drosophila_2:1638462_at:508:689; Interrogation_Position=1683; Antisense; TATTGCCCACAGTGTGATCGATCGA
>probe:Drosophila_2:1638462_at:349:383; Interrogation_Position=1731; Antisense; GAACTTAACCAGTCTTTGCAGCAAT
>probe:Drosophila_2:1638462_at:356:617; Interrogation_Position=1747; Antisense; TGCAGCAATCTGACGCTAAATTATG
>probe:Drosophila_2:1638462_at:123:175; Interrogation_Position=1790; Antisense; AAACCGGTCTTAACATCGATTGGCA
>probe:Drosophila_2:1638462_at:441:465; Interrogation_Position=1807; Antisense; GATTGGCACCAAACACTGATGGAAT
>probe:Drosophila_2:1638462_at:329:389; Interrogation_Position=1834; Antisense; GAAACAGCGGTTTATCGTATTAAGT
>probe:Drosophila_2:1638462_at:516:679; Interrogation_Position=1875; Antisense; TAGTGCTGACTTCCAGGCCACAGTG
>probe:Drosophila_2:1638462_at:390:33; Interrogation_Position=1907; Antisense; ATAATTCCACCCAAAATGCTCAAGT
>probe:Drosophila_2:1638462_at:318:563; Interrogation_Position=1968; Antisense; GGAAGACTCCACATGCATCGATGAT
>probe:Drosophila_2:1638462_at:119:723; Interrogation_Position=2010; Antisense; TTGTATTTGCTTTAGTGACCTCCAC
>probe:Drosophila_2:1638462_at:445:507; Interrogation_Position=2024; Antisense; GTGACCTCCACTGATTAAGTCTCTT
>probe:Drosophila_2:1638462_at:519:477; Interrogation_Position=2094; Antisense; GTTTTCAACTGCATTCCTTTGCTAG
>probe:Drosophila_2:1638462_at:465:675; Interrogation_Position=2116; Antisense; TAGCAGCATTCCCAAGCCAGATGAA
>probe:Drosophila_2:1638462_at:530:221; Interrogation_Position=2159; Antisense; AAGGGCCAACCGACAGCTTAGGAGA

Paste this into a BLAST search page for me
TATTGCCCACAGTGTGATCGATCGAGAACTTAACCAGTCTTTGCAGCAATTGCAGCAATCTGACGCTAAATTATGAAACCGGTCTTAACATCGATTGGCAGATTGGCACCAAACACTGATGGAATGAAACAGCGGTTTATCGTATTAAGTTAGTGCTGACTTCCAGGCCACAGTGATAATTCCACCCAAAATGCTCAAGTGGAAGACTCCACATGCATCGATGATTTGTATTTGCTTTAGTGACCTCCACGTGACCTCCACTGATTAAGTCTCTTGTTTTCAACTGCATTCCTTTGCTAGTAGCAGCATTCCCAAGCCAGATGAAAAGGGCCAACCGACAGCTTAGGAGA

Full Affymetrix probeset data:

Annotations for 1638462_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime