FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638463_at:

>probe:Drosophila_2:1638463_at:458:207; Interrogation_Position=1049; Antisense; AAGCTACGACCATGGGAGGGACCTC
>probe:Drosophila_2:1638463_at:638:205; Interrogation_Position=1105; Antisense; AAGCGACCCAGATTCAGGGACTTTA
>probe:Drosophila_2:1638463_at:327:215; Interrogation_Position=1129; Antisense; AAGAGGAATCGTACGGCAGCTCCCC
>probe:Drosophila_2:1638463_at:178:259; Interrogation_Position=693; Antisense; CAGCTACAGTATTATCACCTTCCAG
>probe:Drosophila_2:1638463_at:173:651; Interrogation_Position=707; Antisense; TCACCTTCCAGTCCAGCAAAATTAT
>probe:Drosophila_2:1638463_at:613:121; Interrogation_Position=756; Antisense; AGCGATCCTGGAAACCGAGCAGCAG
>probe:Drosophila_2:1638463_at:431:121; Interrogation_Position=803; Antisense; AGCGAGTTAGCGACAAGGAGGCCTT
>probe:Drosophila_2:1638463_at:204:75; Interrogation_Position=818; Antisense; AGGAGGCCTTGGCTACATTGCGTCC
>probe:Drosophila_2:1638463_at:426:7; Interrogation_Position=834; Antisense; ATTGCGTCCGGCTACCGAACTGCAG
>probe:Drosophila_2:1638463_at:439:195; Interrogation_Position=851; Antisense; AACTGCAGTGGCATCGTGTTACCAA
>probe:Drosophila_2:1638463_at:283:673; Interrogation_Position=870; Antisense; TACCAAGCTGGTAAACAACTCGCGA
>probe:Drosophila_2:1638463_at:458:435; Interrogation_Position=904; Antisense; GAGGAGTGCAACAAGCCGATCGAAT
>probe:Drosophila_2:1638463_at:154:635; Interrogation_Position=923; Antisense; TCGAATTGGCGGCTAAGCCCGCAAA
>probe:Drosophila_2:1638463_at:226:605; Interrogation_Position=968; Antisense; TGATGTCTTGGCTGAATGCCCGTAA

Paste this into a BLAST search page for me
AAGCTACGACCATGGGAGGGACCTCAAGCGACCCAGATTCAGGGACTTTAAAGAGGAATCGTACGGCAGCTCCCCCAGCTACAGTATTATCACCTTCCAGTCACCTTCCAGTCCAGCAAAATTATAGCGATCCTGGAAACCGAGCAGCAGAGCGAGTTAGCGACAAGGAGGCCTTAGGAGGCCTTGGCTACATTGCGTCCATTGCGTCCGGCTACCGAACTGCAGAACTGCAGTGGCATCGTGTTACCAATACCAAGCTGGTAAACAACTCGCGAGAGGAGTGCAACAAGCCGATCGAATTCGAATTGGCGGCTAAGCCCGCAAATGATGTCTTGGCTGAATGCCCGTAA

Full Affymetrix probeset data:

Annotations for 1638463_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720