Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638465_at:

>probe:Drosophila_2:1638465_at:137:403; Interrogation_Position=2340; Antisense; GACTACATAGATCCCTTTGACTTCG
>probe:Drosophila_2:1638465_at:295:273; Interrogation_Position=2354; Antisense; CTTTGACTTCGAGCTGTTTGCCGAG
>probe:Drosophila_2:1638465_at:682:115; Interrogation_Position=2377; Antisense; AGCATATAACCGCTCATGTGTCCCG
>probe:Drosophila_2:1638465_at:135:617; Interrogation_Position=2405; Antisense; TGCAAGCCGTCTGCAGGGTGAACTG
>probe:Drosophila_2:1638465_at:405:581; Interrogation_Position=2488; Antisense; TGGCCCATGAAGCAGATCCCAATGT
>probe:Drosophila_2:1638465_at:211:231; Interrogation_Position=2508; Antisense; AATGTGCTGTGTCTCAGTTCTTCCG
>probe:Drosophila_2:1638465_at:730:47; Interrogation_Position=2571; Antisense; ATGCCCCAAGCTGCCGGAAGAGTTA
>probe:Drosophila_2:1638465_at:421:559; Interrogation_Position=2608; Antisense; GGAAATCTCCGATCCAAGAGCCAGT
>probe:Drosophila_2:1638465_at:164:167; Interrogation_Position=2703; Antisense; AAATCCAAATCGAGCGCAGCTTCCT
>probe:Drosophila_2:1638465_at:640:115; Interrogation_Position=2720; Antisense; AGCTTCCTTCTTTGGGATGTCCCAG
>probe:Drosophila_2:1638465_at:500:59; Interrogation_Position=2736; Antisense; ATGTCCCAGGAGTGGTTTCGCTAGA
>probe:Drosophila_2:1638465_at:422:83; Interrogation_Position=2773; Antisense; AGTGGCCTGTGAAGTGCATTCGAGC
>probe:Drosophila_2:1638465_at:187:547; Interrogation_Position=2805; Antisense; GGATGGGATGCTCTTCTATTGTTAA
>probe:Drosophila_2:1638465_at:450:289; Interrogation_Position=2876; Antisense; CGGGCAGCGCCCAGTAAATTGTAAG

Paste this into a BLAST search page for me
GACTACATAGATCCCTTTGACTTCGCTTTGACTTCGAGCTGTTTGCCGAGAGCATATAACCGCTCATGTGTCCCGTGCAAGCCGTCTGCAGGGTGAACTGTGGCCCATGAAGCAGATCCCAATGTAATGTGCTGTGTCTCAGTTCTTCCGATGCCCCAAGCTGCCGGAAGAGTTAGGAAATCTCCGATCCAAGAGCCAGTAAATCCAAATCGAGCGCAGCTTCCTAGCTTCCTTCTTTGGGATGTCCCAGATGTCCCAGGAGTGGTTTCGCTAGAAGTGGCCTGTGAAGTGCATTCGAGCGGATGGGATGCTCTTCTATTGTTAACGGGCAGCGCCCAGTAAATTGTAAG

Full Affymetrix probeset data:

Annotations for 1638465_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime