FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638468_at:

>probe:Drosophila_2:1638468_at:573:165; Interrogation_Position=116; Antisense; AAATCTGTACGATGCACCCAGGGCA
>probe:Drosophila_2:1638468_at:524:691; Interrogation_Position=166; Antisense; TATTGGACATTTCTGCTGAGCATCG
>probe:Drosophila_2:1638468_at:352:223; Interrogation_Position=196; Antisense; AAGGATCCCTGGCTTATTGGCCTTA
>probe:Drosophila_2:1638468_at:478:581; Interrogation_Position=213; Antisense; TGGCCTTATTTTGGCGCATATCTTA
>probe:Drosophila_2:1638468_at:399:477; Interrogation_Position=283; Antisense; GTTTTCCTCTTCCTAGTACTGTTGC
>probe:Drosophila_2:1638468_at:146:585; Interrogation_Position=308; Antisense; TGGCAGTCTACTTCACCGAAAGCAT
>probe:Drosophila_2:1638468_at:254:471; Interrogation_Position=339; Antisense; GTTCGCTGCTAACAACTGGAGTTCC
>probe:Drosophila_2:1638468_at:217:551; Interrogation_Position=356; Antisense; GGAGTTCCTTTTCCAGACAACAATA
>probe:Drosophila_2:1638468_at:217:25; Interrogation_Position=386; Antisense; ATAGCAACGGCCTGTTTATCTCGAC
>probe:Drosophila_2:1638468_at:183:11; Interrogation_Position=403; Antisense; ATCTCGACAGTTTTCTCAATACCTA
>probe:Drosophila_2:1638468_at:19:725; Interrogation_Position=448; Antisense; TTGATTGGCACTTGGCTCTACAACT
>probe:Drosophila_2:1638468_at:727:135; Interrogation_Position=475; Antisense; ACGCAGCTGATGGTGACTCTAAAAA
>probe:Drosophila_2:1638468_at:216:681; Interrogation_Position=49; Antisense; TATGTTTGTTTTGACTCGGCTTTCG
>probe:Drosophila_2:1638468_at:257:419; Interrogation_Position=518; Antisense; GAGCTCGCAAGGAACGCCAGACTAA

Paste this into a BLAST search page for me
AAATCTGTACGATGCACCCAGGGCATATTGGACATTTCTGCTGAGCATCGAAGGATCCCTGGCTTATTGGCCTTATGGCCTTATTTTGGCGCATATCTTAGTTTTCCTCTTCCTAGTACTGTTGCTGGCAGTCTACTTCACCGAAAGCATGTTCGCTGCTAACAACTGGAGTTCCGGAGTTCCTTTTCCAGACAACAATAATAGCAACGGCCTGTTTATCTCGACATCTCGACAGTTTTCTCAATACCTATTGATTGGCACTTGGCTCTACAACTACGCAGCTGATGGTGACTCTAAAAATATGTTTGTTTTGACTCGGCTTTCGGAGCTCGCAAGGAACGCCAGACTAA

Full Affymetrix probeset data:

Annotations for 1638468_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720