FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638472_at:

>probe:Drosophila_2:1638472_at:239:717; Interrogation_Position=348; Antisense; TTCGCACTGTGGACTACACGGCGGA
>probe:Drosophila_2:1638472_at:313:331; Interrogation_Position=368; Antisense; GCGGACTCCATTCACGGCTTCAATG
>probe:Drosophila_2:1638472_at:190:271; Interrogation_Position=392; Antisense; GCCGTGGTGACCAAGTCGGGACCCA
>probe:Drosophila_2:1638472_at:431:349; Interrogation_Position=487; Antisense; GCAGGTAGTGAAGCACGTGGCTCCA
>probe:Drosophila_2:1638472_at:441:577; Interrogation_Position=544; Antisense; GGCGCCTTATGTGGCCAAGCACTAT
>probe:Drosophila_2:1638472_at:7:137; Interrogation_Position=597; Antisense; ACGACTACGATGATGGCTACTACAA
>probe:Drosophila_2:1638472_at:193:665; Interrogation_Position=617; Antisense; TACAACCAGGGCCAGCAGTACGAGT
>probe:Drosophila_2:1638472_at:270:349; Interrogation_Position=631; Antisense; GCAGTACGAGTACATCCCACAGTAT
>probe:Drosophila_2:1638472_at:357:669; Interrogation_Position=674; Antisense; TACGGCCACTATGCGAGTCCCTATG
>probe:Drosophila_2:1638472_at:315:681; Interrogation_Position=695; Antisense; TATGCGGGCCACTACTAGGACGGAC
>probe:Drosophila_2:1638472_at:314:417; Interrogation_Position=723; Antisense; GAGCTCCCACTTCTTAGTTACTTAA
>probe:Drosophila_2:1638472_at:655:665; Interrogation_Position=741; Antisense; TACTTAAGCCCGCTTAGCTGTACGC
>probe:Drosophila_2:1638472_at:219:317; Interrogation_Position=764; Antisense; GCCTCCACCTGGAACTTCATTGGAT
>probe:Drosophila_2:1638472_at:443:589; Interrogation_Position=784; Antisense; TGGATTCTCTCAGTGTAGCTTGCGA

Paste this into a BLAST search page for me
TTCGCACTGTGGACTACACGGCGGAGCGGACTCCATTCACGGCTTCAATGGCCGTGGTGACCAAGTCGGGACCCAGCAGGTAGTGAAGCACGTGGCTCCAGGCGCCTTATGTGGCCAAGCACTATACGACTACGATGATGGCTACTACAATACAACCAGGGCCAGCAGTACGAGTGCAGTACGAGTACATCCCACAGTATTACGGCCACTATGCGAGTCCCTATGTATGCGGGCCACTACTAGGACGGACGAGCTCCCACTTCTTAGTTACTTAATACTTAAGCCCGCTTAGCTGTACGCGCCTCCACCTGGAACTTCATTGGATTGGATTCTCTCAGTGTAGCTTGCGA

Full Affymetrix probeset data:

Annotations for 1638472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720