FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638473_at:

>probe:Drosophila_2:1638473_at:246:153; Interrogation_Position=1004; Antisense; ACAGTGGAGGTCCTTTGCACATCGT
>probe:Drosophila_2:1638473_at:313:149; Interrogation_Position=1022; Antisense; ACATCGTGGCCAGCGGAACGCGAGA
>probe:Drosophila_2:1638473_at:153:425; Interrogation_Position=1043; Antisense; GAGAGCATCAGATCGCCGGCGTTGT
>probe:Drosophila_2:1638473_at:285:81; Interrogation_Position=1079; Antisense; AGGGCTGTGCCAAGGCCGGTTATCC
>probe:Drosophila_2:1638473_at:197:499; Interrogation_Position=1108; Antisense; GTCTATGCCAGAGTGAATCGCTACG
>probe:Drosophila_2:1638473_at:680:367; Interrogation_Position=1122; Antisense; GAATCGCTACGGAACCTGGATCAAG
>probe:Drosophila_2:1638473_at:344:93; Interrogation_Position=1232; Antisense; AGTTCAATACTCTTGCTTGGCTGGC
>probe:Drosophila_2:1638473_at:444:363; Interrogation_Position=1276; Antisense; GAATTTGTATCTTCCATCCAATGTG
>probe:Drosophila_2:1638473_at:23:179; Interrogation_Position=1418; Antisense; AAACTTTTTGCCACCCTTGCAAGAG
>probe:Drosophila_2:1638473_at:654:83; Interrogation_Position=1441; Antisense; AGTAAGTCAACTTCGGCTTCGTCGA
>probe:Drosophila_2:1638473_at:281:343; Interrogation_Position=1456; Antisense; GCTTCGTCGAAGATCCCATTTTCAA
>probe:Drosophila_2:1638473_at:489:449; Interrogation_Position=1467; Antisense; GATCCCATTTTCAAGCTGTTTTATA
>probe:Drosophila_2:1638473_at:506:501; Interrogation_Position=926; Antisense; GTCGCTATGGCAACAAGATCACGGA
>probe:Drosophila_2:1638473_at:17:663; Interrogation_Position=951; Antisense; TAACATGCTGTGTGGCGGATACGAC

Paste this into a BLAST search page for me
ACAGTGGAGGTCCTTTGCACATCGTACATCGTGGCCAGCGGAACGCGAGAGAGAGCATCAGATCGCCGGCGTTGTAGGGCTGTGCCAAGGCCGGTTATCCGTCTATGCCAGAGTGAATCGCTACGGAATCGCTACGGAACCTGGATCAAGAGTTCAATACTCTTGCTTGGCTGGCGAATTTGTATCTTCCATCCAATGTGAAACTTTTTGCCACCCTTGCAAGAGAGTAAGTCAACTTCGGCTTCGTCGAGCTTCGTCGAAGATCCCATTTTCAAGATCCCATTTTCAAGCTGTTTTATAGTCGCTATGGCAACAAGATCACGGATAACATGCTGTGTGGCGGATACGAC

Full Affymetrix probeset data:

Annotations for 1638473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720