Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638475_a_at:

>probe:Drosophila_2:1638475_a_at:219:17; Interrogation_Position=110; Antisense; ATTTTCGGCCTTGTGGCGATGTGCG
>probe:Drosophila_2:1638475_a_at:93:63; Interrogation_Position=128; Antisense; ATGTGCGTGCTGGTGGCCAACGCCA
>probe:Drosophila_2:1638475_a_at:368:133; Interrogation_Position=147; Antisense; ACGCCAGTGAGGAGGCACCCAAGAA
>probe:Drosophila_2:1638475_a_at:7:729; Interrogation_Position=222; Antisense; TTGGCCACGGTCTGGGCTACGGATA
>probe:Drosophila_2:1638475_a_at:445:277; Interrogation_Position=238; Antisense; CTACGGATACGGACCATCGGCGGGA
>probe:Drosophila_2:1638475_a_at:622:439; Interrogation_Position=261; Antisense; GAGGCGCCATTCTGGGATCCGGCAT
>probe:Drosophila_2:1638475_a_at:363:47; Interrogation_Position=277; Antisense; ATCCGGCATCGGTGTTGGAGTTCCA
>probe:Drosophila_2:1638475_a_at:294:81; Interrogation_Position=333; Antisense; AGGTGCACACCAACACCGTGGTGAG
>probe:Drosophila_2:1638475_a_at:89:605; Interrogation_Position=354; Antisense; TGAGGACCGTGCAGGTGCCCTACCA
>probe:Drosophila_2:1638475_a_at:156:129; Interrogation_Position=375; Antisense; ACCAGGTGGAGCGTCACGTTCCCTA
>probe:Drosophila_2:1638475_a_at:690:373; Interrogation_Position=409; Antisense; GAAGACCGTCACCTATCCCGTTAAG
>probe:Drosophila_2:1638475_a_at:204:63; Interrogation_Position=474; Antisense; ATGTGCCCGTCAAGCAGATCGTGAA
>probe:Drosophila_2:1638475_a_at:74:529; Interrogation_Position=560; Antisense; GGGTGAAGGCGAGCGAACCAACCAA
>probe:Drosophila_2:1638475_a_at:231:481; Interrogation_Position=623; Antisense; GTTTGTGATACCAACCGAAATTCTG

Paste this into a BLAST search page for me
ATTTTCGGCCTTGTGGCGATGTGCGATGTGCGTGCTGGTGGCCAACGCCAACGCCAGTGAGGAGGCACCCAAGAATTGGCCACGGTCTGGGCTACGGATACTACGGATACGGACCATCGGCGGGAGAGGCGCCATTCTGGGATCCGGCATATCCGGCATCGGTGTTGGAGTTCCAAGGTGCACACCAACACCGTGGTGAGTGAGGACCGTGCAGGTGCCCTACCAACCAGGTGGAGCGTCACGTTCCCTAGAAGACCGTCACCTATCCCGTTAAGATGTGCCCGTCAAGCAGATCGTGAAGGGTGAAGGCGAGCGAACCAACCAAGTTTGTGATACCAACCGAAATTCTG

Full Affymetrix probeset data:

Annotations for 1638475_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime