FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638477_at:

>probe:Drosophila_2:1638477_at:527:361; Interrogation_Position=115; Antisense; GCAATGAACTCCGTAACCGTACTCG
>probe:Drosophila_2:1638477_at:650:111; Interrogation_Position=20; Antisense; AGCAACAGTTGATCGCCAGCGTCCA
>probe:Drosophila_2:1638477_at:476:483; Interrogation_Position=252; Antisense; GTATCCATCGTACTCGAGCGGATCT
>probe:Drosophila_2:1638477_at:567:121; Interrogation_Position=268; Antisense; AGCGGATCTGGTTATTACTCGGGTG
>probe:Drosophila_2:1638477_at:510:701; Interrogation_Position=279; Antisense; TTATTACTCGGGTGGCGGCAGCTAC
>probe:Drosophila_2:1638477_at:162:249; Interrogation_Position=311; Antisense; CAATCATCTCGTCCAGCTACAAGAA
>probe:Drosophila_2:1638477_at:614:117; Interrogation_Position=325; Antisense; AGCTACAAGAACTACGCGGTGCCGC
>probe:Drosophila_2:1638477_at:382:329; Interrogation_Position=340; Antisense; GCGGTGCCGCAGTACACAACCTATG
>probe:Drosophila_2:1638477_at:233:325; Interrogation_Position=391; Antisense; GCGAATGCGGGCTACACCGGCTACT
>probe:Drosophila_2:1638477_at:473:669; Interrogation_Position=430; Antisense; TACTCCGGCTACAATGGATTGGACA
>probe:Drosophila_2:1638477_at:113:567; Interrogation_Position=463; Antisense; GGCAGCAATGGTGGCTACGTCTACT
>probe:Drosophila_2:1638477_at:104:291; Interrogation_Position=47; Antisense; CGGTGCATACACAGCTACAGGAATT
>probe:Drosophila_2:1638477_at:622:267; Interrogation_Position=64; Antisense; CAGGAATTCCAATCCTCTCAAGCAA
>probe:Drosophila_2:1638477_at:585:361; Interrogation_Position=95; Antisense; GAGCTTACCCAAAAGTTCCCGCAAT

Paste this into a BLAST search page for me
GCAATGAACTCCGTAACCGTACTCGAGCAACAGTTGATCGCCAGCGTCCAGTATCCATCGTACTCGAGCGGATCTAGCGGATCTGGTTATTACTCGGGTGTTATTACTCGGGTGGCGGCAGCTACCAATCATCTCGTCCAGCTACAAGAAAGCTACAAGAACTACGCGGTGCCGCGCGGTGCCGCAGTACACAACCTATGGCGAATGCGGGCTACACCGGCTACTTACTCCGGCTACAATGGATTGGACAGGCAGCAATGGTGGCTACGTCTACTCGGTGCATACACAGCTACAGGAATTCAGGAATTCCAATCCTCTCAAGCAAGAGCTTACCCAAAAGTTCCCGCAAT

Full Affymetrix probeset data:

Annotations for 1638477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720