FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638478_at:

>probe:Drosophila_2:1638478_at:203:459; Interrogation_Position=1062; Antisense; GATATACCCTAAGCCTAAGCCATGA
>probe:Drosophila_2:1638478_at:169:201; Interrogation_Position=1078; Antisense; AAGCCATGACTTCCCGTTAGCAGTA
>probe:Drosophila_2:1638478_at:39:477; Interrogation_Position=1183; Antisense; GTTATCATACCCATTACTCATAGAG
>probe:Drosophila_2:1638478_at:511:611; Interrogation_Position=729; Antisense; TGACGATAATGAGCGCACCTGCCAC
>probe:Drosophila_2:1638478_at:644:353; Interrogation_Position=743; Antisense; GCACCTGCCACCTGTGTAAAATAGT
>probe:Drosophila_2:1638478_at:702:587; Interrogation_Position=767; Antisense; TGGTCACCTCTGCTGCACAAATGCA
>probe:Drosophila_2:1638478_at:298:167; Interrogation_Position=785; Antisense; AAATGCAGGCCCACTTGGCTGGAGC
>probe:Drosophila_2:1638478_at:136:555; Interrogation_Position=830; Antisense; GGACCTCCCGGCAGGATCAGAATCA
>probe:Drosophila_2:1638478_at:308:557; Interrogation_Position=861; Antisense; GGCGCCGATCCCTGAAACGGAGAAA
>probe:Drosophila_2:1638478_at:62:99; Interrogation_Position=888; Antisense; AGATGCCGCGGAACTGGCCTTGTAT
>probe:Drosophila_2:1638478_at:120:355; Interrogation_Position=914; Antisense; GCACTCCAATGGGTCAGTACTACTG
>probe:Drosophila_2:1638478_at:551:313; Interrogation_Position=938; Antisense; GCCAGCCCTGCAACATGATGATGAA
>probe:Drosophila_2:1638478_at:301:445; Interrogation_Position=957; Antisense; GATGAACCATGAGAGCACCTTGCAA
>probe:Drosophila_2:1638478_at:195:421; Interrogation_Position=969; Antisense; GAGCACCTTGCAACAGCACTTTATT

Paste this into a BLAST search page for me
GATATACCCTAAGCCTAAGCCATGAAAGCCATGACTTCCCGTTAGCAGTAGTTATCATACCCATTACTCATAGAGTGACGATAATGAGCGCACCTGCCACGCACCTGCCACCTGTGTAAAATAGTTGGTCACCTCTGCTGCACAAATGCAAAATGCAGGCCCACTTGGCTGGAGCGGACCTCCCGGCAGGATCAGAATCAGGCGCCGATCCCTGAAACGGAGAAAAGATGCCGCGGAACTGGCCTTGTATGCACTCCAATGGGTCAGTACTACTGGCCAGCCCTGCAACATGATGATGAAGATGAACCATGAGAGCACCTTGCAAGAGCACCTTGCAACAGCACTTTATT

Full Affymetrix probeset data:

Annotations for 1638478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720