FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638480_at:

>probe:Drosophila_2:1638480_at:133:321; Interrogation_Position=1073; Antisense; GCCGCCAGTCAAAAGGTTCCGCAAT
>probe:Drosophila_2:1638480_at:246:43; Interrogation_Position=1102; Antisense; ATCGACGGTCGAACACATATCGGGA
>probe:Drosophila_2:1638480_at:43:423; Interrogation_Position=1157; Antisense; GAGAAAGCCAACTGATGATCGTCAT
>probe:Drosophila_2:1638480_at:28:13; Interrogation_Position=1242; Antisense; ATTACATTCGGCGACGACGGCCAGG
>probe:Drosophila_2:1638480_at:526:267; Interrogation_Position=1263; Antisense; CAGGCGGCGGAAATTATTGCTCCAA
>probe:Drosophila_2:1638480_at:550:33; Interrogation_Position=1290; Antisense; ATCAATCAATTAACCGCTACTGCTG
>probe:Drosophila_2:1638480_at:483:371; Interrogation_Position=1361; Antisense; GAAGTTTAAGCCGAAAATTGCCGCG
>probe:Drosophila_2:1638480_at:698:161; Interrogation_Position=1375; Antisense; AAATTGCCGCGTTTCAGGGCACAAA
>probe:Drosophila_2:1638480_at:17:365; Interrogation_Position=846; Antisense; GAATCTAAGCCAAAACCCTTCGAGA
>probe:Drosophila_2:1638480_at:104:103; Interrogation_Position=884; Antisense; AGAGCAGAAGCCTAAGCCACGATTA
>probe:Drosophila_2:1638480_at:25:395; Interrogation_Position=909; Antisense; GAAAGGCAGCCAAGTATCGATGAAG
>probe:Drosophila_2:1638480_at:325:655; Interrogation_Position=953; Antisense; TAATCGTCCCACACATGTCGTTGAT
>probe:Drosophila_2:1638480_at:537:467; Interrogation_Position=972; Antisense; GTTGATCCCTTCTTCATTACGGAAT
>probe:Drosophila_2:1638480_at:282:645; Interrogation_Position=985; Antisense; TCATTACGGAATCAGGCCAGCCCTA

Paste this into a BLAST search page for me
GCCGCCAGTCAAAAGGTTCCGCAATATCGACGGTCGAACACATATCGGGAGAGAAAGCCAACTGATGATCGTCATATTACATTCGGCGACGACGGCCAGGCAGGCGGCGGAAATTATTGCTCCAAATCAATCAATTAACCGCTACTGCTGGAAGTTTAAGCCGAAAATTGCCGCGAAATTGCCGCGTTTCAGGGCACAAAGAATCTAAGCCAAAACCCTTCGAGAAGAGCAGAAGCCTAAGCCACGATTAGAAAGGCAGCCAAGTATCGATGAAGTAATCGTCCCACACATGTCGTTGATGTTGATCCCTTCTTCATTACGGAATTCATTACGGAATCAGGCCAGCCCTA

Full Affymetrix probeset data:

Annotations for 1638480_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720