FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638481_at:

>probe:Drosophila_2:1638481_at:542:303; Interrogation_Position=1228; Antisense; CCGAGGATCACGAGCCATACATTTT
>probe:Drosophila_2:1638481_at:264:29; Interrogation_Position=1244; Antisense; ATACATTTTGCTGGAGCCGGTCACT
>probe:Drosophila_2:1638481_at:470:669; Interrogation_Position=1280; Antisense; TACGGAGAAATACCGCTTCCAGTCC
>probe:Drosophila_2:1638481_at:48:649; Interrogation_Position=1324; Antisense; TCAGGAGGTTTAGCTCACGCCTAAG
>probe:Drosophila_2:1638481_at:706:511; Interrogation_Position=1416; Antisense; GTGACCTCCCTTATGTGGATCAACG
>probe:Drosophila_2:1638481_at:683:273; Interrogation_Position=1445; Antisense; CATTGTCCAACACATACAGCCGTAT
>probe:Drosophila_2:1638481_at:680:5; Interrogation_Position=1468; Antisense; ATTGCATGGTTCTTTTTCTGGTCCT
>probe:Drosophila_2:1638481_at:210:631; Interrogation_Position=1489; Antisense; TCCTGGCCTTGTGGAGTGTCCTAAA
>probe:Drosophila_2:1638481_at:711:275; Interrogation_Position=1544; Antisense; CTATGTGGTCCTCTTCCGGAAGTTA
>probe:Drosophila_2:1638481_at:452:61; Interrogation_Position=1568; Antisense; ATGTGGCGATTTGGGCACGGTCACC
>probe:Drosophila_2:1638481_at:668:677; Interrogation_Position=1597; Antisense; TAGAGACCAAGTTCCAGGCCACTAG
>probe:Drosophila_2:1638481_at:565:481; Interrogation_Position=1649; Antisense; GTGATTTACTTTCTGGACTGGACCC
>probe:Drosophila_2:1638481_at:159:435; Interrogation_Position=1709; Antisense; GAGGTGTCGCTACTGATGAACTATC
>probe:Drosophila_2:1638481_at:364:613; Interrogation_Position=1725; Antisense; TGAACTATCAGTAGTCCGCCGTTAC

Paste this into a BLAST search page for me
CCGAGGATCACGAGCCATACATTTTATACATTTTGCTGGAGCCGGTCACTTACGGAGAAATACCGCTTCCAGTCCTCAGGAGGTTTAGCTCACGCCTAAGGTGACCTCCCTTATGTGGATCAACGCATTGTCCAACACATACAGCCGTATATTGCATGGTTCTTTTTCTGGTCCTTCCTGGCCTTGTGGAGTGTCCTAAACTATGTGGTCCTCTTCCGGAAGTTAATGTGGCGATTTGGGCACGGTCACCTAGAGACCAAGTTCCAGGCCACTAGGTGATTTACTTTCTGGACTGGACCCGAGGTGTCGCTACTGATGAACTATCTGAACTATCAGTAGTCCGCCGTTAC

Full Affymetrix probeset data:

Annotations for 1638481_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720