FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638483_at:

>probe:Drosophila_2:1638483_at:549:13; Interrogation_Position=1130; Antisense; ATTAACCGCATGTGAGCCACCGAGC
>probe:Drosophila_2:1638483_at:661:115; Interrogation_Position=1152; Antisense; AGCATGCCGCTCTACAATCACTGGG
>probe:Drosophila_2:1638483_at:187:665; Interrogation_Position=1164; Antisense; TACAATCACTGGGTCGACTGCCTTA
>probe:Drosophila_2:1638483_at:547:501; Interrogation_Position=1176; Antisense; GTCGACTGCCTTACGGATCTCTATG
>probe:Drosophila_2:1638483_at:163:175; Interrogation_Position=1214; Antisense; AAACCGTGGTGCCATTCTCTTCTGG
>probe:Drosophila_2:1638483_at:66:645; Interrogation_Position=1231; Antisense; TCTTCTGGCGCACGGTGCCCAAGAT
>probe:Drosophila_2:1638483_at:458:625; Interrogation_Position=1246; Antisense; TGCCCAAGATCCAGTTGCTGCGCAG
>probe:Drosophila_2:1638483_at:123:337; Interrogation_Position=1262; Antisense; GCTGCGCAGCAAGGATAATTACACT
>probe:Drosophila_2:1638483_at:688:31; Interrogation_Position=1353; Antisense; ATCAATCGATGGCAAGCACGGAAAA
>probe:Drosophila_2:1638483_at:641:421; Interrogation_Position=1439; Antisense; GAGAATATTTCCTGGAGCGTACATT
>probe:Drosophila_2:1638483_at:625:121; Interrogation_Position=1454; Antisense; AGCGTACATTTTGGATCGTGAAGAA
>probe:Drosophila_2:1638483_at:454:387; Interrogation_Position=1553; Antisense; GAAAAACATTTGATACGAGGACTAC
>probe:Drosophila_2:1638483_at:568:203; Interrogation_Position=1625; Antisense; AACCAAAGGCAATCATCGTTTACTG
>probe:Drosophila_2:1638483_at:431:43; Interrogation_Position=1639; Antisense; ATCGTTTACTGATCTGTGCGAGAAA

Paste this into a BLAST search page for me
ATTAACCGCATGTGAGCCACCGAGCAGCATGCCGCTCTACAATCACTGGGTACAATCACTGGGTCGACTGCCTTAGTCGACTGCCTTACGGATCTCTATGAAACCGTGGTGCCATTCTCTTCTGGTCTTCTGGCGCACGGTGCCCAAGATTGCCCAAGATCCAGTTGCTGCGCAGGCTGCGCAGCAAGGATAATTACACTATCAATCGATGGCAAGCACGGAAAAGAGAATATTTCCTGGAGCGTACATTAGCGTACATTTTGGATCGTGAAGAAGAAAAACATTTGATACGAGGACTACAACCAAAGGCAATCATCGTTTACTGATCGTTTACTGATCTGTGCGAGAAA

Full Affymetrix probeset data:

Annotations for 1638483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720