FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638484_at:

>probe:Drosophila_2:1638484_at:632:9; Interrogation_Position=107; Antisense; ATTCGCGGCAGCATCATGATCTTGA
>probe:Drosophila_2:1638484_at:171:59; Interrogation_Position=122; Antisense; ATGATCTTGATTTGCACACCCTGGG
>probe:Drosophila_2:1638484_at:571:313; Interrogation_Position=15; Antisense; GCCAGATATTCCCTTTGTCTTGAAT
>probe:Drosophila_2:1638484_at:12:609; Interrogation_Position=218; Antisense; TGAGCCGCGGTGGAGCCTCAAATAA
>probe:Drosophila_2:1638484_at:726:525; Interrogation_Position=246; Antisense; GGGCAATTTCGAGGTCCATCTGGAT
>probe:Drosophila_2:1638484_at:383:509; Interrogation_Position=271; Antisense; GTGGGACTCTTTCAGCCAGGTGAAC
>probe:Drosophila_2:1638484_at:245:723; Interrogation_Position=29; Antisense; TTGTCTTGAATTTGGACTCCCCGGA
>probe:Drosophila_2:1638484_at:696:453; Interrogation_Position=358; Antisense; GATCATGGACATGTATCCCGGCATT
>probe:Drosophila_2:1638484_at:119:49; Interrogation_Position=422; Antisense; ATGCCATTGTTTCCACTTTGTCGGA
>probe:Drosophila_2:1638484_at:424:427; Interrogation_Position=452; Antisense; GAGTTCTCAATATCACGGTTCCACC
>probe:Drosophila_2:1638484_at:414:541; Interrogation_Position=468; Antisense; GGTTCCACCATTAGTTTCCAAGGAG
>probe:Drosophila_2:1638484_at:713:553; Interrogation_Position=501; Antisense; GGAGCGCATCATACCCATTAAGCAT
>probe:Drosophila_2:1638484_at:40:535; Interrogation_Position=529; Antisense; GGTCCATCGGATCTCTTCCAGAATG
>probe:Drosophila_2:1638484_at:166:61; Interrogation_Position=58; Antisense; ATGTACTACGGCCACGATATGTTCC

Paste this into a BLAST search page for me
ATTCGCGGCAGCATCATGATCTTGAATGATCTTGATTTGCACACCCTGGGGCCAGATATTCCCTTTGTCTTGAATTGAGCCGCGGTGGAGCCTCAAATAAGGGCAATTTCGAGGTCCATCTGGATGTGGGACTCTTTCAGCCAGGTGAACTTGTCTTGAATTTGGACTCCCCGGAGATCATGGACATGTATCCCGGCATTATGCCATTGTTTCCACTTTGTCGGAGAGTTCTCAATATCACGGTTCCACCGGTTCCACCATTAGTTTCCAAGGAGGGAGCGCATCATACCCATTAAGCATGGTCCATCGGATCTCTTCCAGAATGATGTACTACGGCCACGATATGTTCC

Full Affymetrix probeset data:

Annotations for 1638484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720