FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638486_at:

>probe:Drosophila_2:1638486_at:446:159; Interrogation_Position=1016; Antisense; ACAAAACAGTTTGCACAGCTTTCAT
>probe:Drosophila_2:1638486_at:361:615; Interrogation_Position=1027; Antisense; TGCACAGCTTTCATTTTTGTTCCCC
>probe:Drosophila_2:1638486_at:338:689; Interrogation_Position=1073; Antisense; TATTTAGCAGTATTTAACACTCCTA
>probe:Drosophila_2:1638486_at:177:661; Interrogation_Position=1087; Antisense; TAACACTCCTATTTTGCAGCTCTTT
>probe:Drosophila_2:1638486_at:479:721; Interrogation_Position=1100; Antisense; TTGCAGCTCTTTGTAAGGCGCGTAT
>probe:Drosophila_2:1638486_at:601:69; Interrogation_Position=1115; Antisense; AGGCGCGTATGTACATACACTTCTT
>probe:Drosophila_2:1638486_at:522:489; Interrogation_Position=1125; Antisense; GTACATACACTTCTTACCATTCTAA
>probe:Drosophila_2:1638486_at:369:147; Interrogation_Position=1133; Antisense; ACTTCTTACCATTCTAAGCTGATTT
>probe:Drosophila_2:1638486_at:520:493; Interrogation_Position=1181; Antisense; GTAATCATTTCTTCTTTACCAATGC
>probe:Drosophila_2:1638486_at:577:643; Interrogation_Position=1190; Antisense; TCTTCTTTACCAATGCGTTTATTTC
>probe:Drosophila_2:1638486_at:131:329; Interrogation_Position=1204; Antisense; GCGTTTATTTCAGGTCACGTTCGCC
>probe:Drosophila_2:1638486_at:337:345; Interrogation_Position=964; Antisense; GCATTAGCAATAATACTCTTATCTT
>probe:Drosophila_2:1638486_at:159:147; Interrogation_Position=978; Antisense; ACTCTTATCTTAATTGGTTCACAGC
>probe:Drosophila_2:1638486_at:323:1; Interrogation_Position=990; Antisense; ATTGGTTCACAGCTTAATTCATAGA

Paste this into a BLAST search page for me
ACAAAACAGTTTGCACAGCTTTCATTGCACAGCTTTCATTTTTGTTCCCCTATTTAGCAGTATTTAACACTCCTATAACACTCCTATTTTGCAGCTCTTTTTGCAGCTCTTTGTAAGGCGCGTATAGGCGCGTATGTACATACACTTCTTGTACATACACTTCTTACCATTCTAAACTTCTTACCATTCTAAGCTGATTTGTAATCATTTCTTCTTTACCAATGCTCTTCTTTACCAATGCGTTTATTTCGCGTTTATTTCAGGTCACGTTCGCCGCATTAGCAATAATACTCTTATCTTACTCTTATCTTAATTGGTTCACAGCATTGGTTCACAGCTTAATTCATAGA

Full Affymetrix probeset data:

Annotations for 1638486_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720