FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638487_at:

>probe:Drosophila_2:1638487_at:416:453; Interrogation_Position=1005; Antisense; GATTAGGTACTGCACTGGCCGACTC
>probe:Drosophila_2:1638487_at:638:725; Interrogation_Position=1033; Antisense; TTGTACCCCTCCATATCGTCATAGT
>probe:Drosophila_2:1638487_at:142:497; Interrogation_Position=1050; Antisense; GTCATAGTCATAGTAGGTTTCACCT
>probe:Drosophila_2:1638487_at:34:229; Interrogation_Position=1136; Antisense; AATGGCGGGCTATTTCAGTGCATGC
>probe:Drosophila_2:1638487_at:87:455; Interrogation_Position=584; Antisense; GTACGAACGCCACACATTAAACTCA
>probe:Drosophila_2:1638487_at:33:457; Interrogation_Position=641; Antisense; GATATCTTGGGACAAGGCACTCTTT
>probe:Drosophila_2:1638487_at:410:225; Interrogation_Position=654; Antisense; AAGGCACTCTTTCCGCTAAATGGAT
>probe:Drosophila_2:1638487_at:331:695; Interrogation_Position=737; Antisense; TTTCCACTACATTTTGTACTGGTAC
>probe:Drosophila_2:1638487_at:180:539; Interrogation_Position=757; Antisense; GGTACTAAACAATTTCGATCGATCA
>probe:Drosophila_2:1638487_at:448:671; Interrogation_Position=783; Antisense; TACGAGAAACCAACGCCAACATTTT
>probe:Drosophila_2:1638487_at:410:389; Interrogation_Position=920; Antisense; GAAACATAAACCCTTCTGGCACCTA
>probe:Drosophila_2:1638487_at:637:567; Interrogation_Position=937; Antisense; GGCACCTACTCAAGCCAACAACTGG
>probe:Drosophila_2:1638487_at:124:581; Interrogation_Position=965; Antisense; TGGCCAAATGGCACAGAGCTACTGG
>probe:Drosophila_2:1638487_at:366:419; Interrogation_Position=980; Antisense; GAGCTACTGGAACCGAATGTCAATC

Paste this into a BLAST search page for me
GATTAGGTACTGCACTGGCCGACTCTTGTACCCCTCCATATCGTCATAGTGTCATAGTCATAGTAGGTTTCACCTAATGGCGGGCTATTTCAGTGCATGCGTACGAACGCCACACATTAAACTCAGATATCTTGGGACAAGGCACTCTTTAAGGCACTCTTTCCGCTAAATGGATTTTCCACTACATTTTGTACTGGTACGGTACTAAACAATTTCGATCGATCATACGAGAAACCAACGCCAACATTTTGAAACATAAACCCTTCTGGCACCTAGGCACCTACTCAAGCCAACAACTGGTGGCCAAATGGCACAGAGCTACTGGGAGCTACTGGAACCGAATGTCAATC

Full Affymetrix probeset data:

Annotations for 1638487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720