Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638490_at:

>probe:Drosophila_2:1638490_at:500:35; Interrogation_Position=1898; Antisense; ATCAGGTGATTGGAGCTCTGACCAG
>probe:Drosophila_2:1638490_at:646:223; Interrogation_Position=1942; Antisense; AAGGAGCTCTCCGATCTGGCCATTG
>probe:Drosophila_2:1638490_at:582:579; Interrogation_Position=1958; Antisense; TGGCCATTGCCCACGAGTACGGCGA
>probe:Drosophila_2:1638490_at:131:457; Interrogation_Position=1997; Antisense; GATACACTCGTCTCAAGCAGCAGCT
>probe:Drosophila_2:1638490_at:629:351; Interrogation_Position=2013; Antisense; GCAGCAGCTGGACAATCTAAACGAG
>probe:Drosophila_2:1638490_at:103:569; Interrogation_Position=2133; Antisense; GGCAGCACACGTAGCAACACCAAGC
>probe:Drosophila_2:1638490_at:668:185; Interrogation_Position=2148; Antisense; AACACCAAGCTGTGCCCAGGAGCTG
>probe:Drosophila_2:1638490_at:416:119; Interrogation_Position=2168; Antisense; AGCTGCCCAAGTTGGATGTGCTGGT
>probe:Drosophila_2:1638490_at:357:263; Interrogation_Position=2194; Antisense; CAGCGATTGCAATTGGACCAGGGAC
>probe:Drosophila_2:1638490_at:234:489; Interrogation_Position=2222; Antisense; GTACGCAGCAAACGCTGGACACGCT
>probe:Drosophila_2:1638490_at:303:547; Interrogation_Position=2253; Antisense; GGAGTCCACCACGTATGCGGAGGAT
>probe:Drosophila_2:1638490_at:184:409; Interrogation_Position=2302; Antisense; GACGACTTTCGTCTGAATCTCGAGC
>probe:Drosophila_2:1638490_at:439:369; Interrogation_Position=2352; Antisense; GAAGGACAAAGTGCTGGGCTACCAG
>probe:Drosophila_2:1638490_at:641:265; Interrogation_Position=2380; Antisense; CAGTTGCAGGCCCACTATATTCAAA

Paste this into a BLAST search page for me
ATCAGGTGATTGGAGCTCTGACCAGAAGGAGCTCTCCGATCTGGCCATTGTGGCCATTGCCCACGAGTACGGCGAGATACACTCGTCTCAAGCAGCAGCTGCAGCAGCTGGACAATCTAAACGAGGGCAGCACACGTAGCAACACCAAGCAACACCAAGCTGTGCCCAGGAGCTGAGCTGCCCAAGTTGGATGTGCTGGTCAGCGATTGCAATTGGACCAGGGACGTACGCAGCAAACGCTGGACACGCTGGAGTCCACCACGTATGCGGAGGATGACGACTTTCGTCTGAATCTCGAGCGAAGGACAAAGTGCTGGGCTACCAGCAGTTGCAGGCCCACTATATTCAAA

Full Affymetrix probeset data:

Annotations for 1638490_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime