FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638494_at:

>probe:Drosophila_2:1638494_at:547:197; Interrogation_Position=1003; Antisense; AACCCTTGAGCCCATCATTAGTTGT
>probe:Drosophila_2:1638494_at:9:491; Interrogation_Position=1032; Antisense; GTACTTTTGCATGATTGGTGTCTCT
>probe:Drosophila_2:1638494_at:87:689; Interrogation_Position=1062; Antisense; TATTTGTTCCAAGACTTCCCCTACG
>probe:Drosophila_2:1638494_at:421:387; Interrogation_Position=1114; Antisense; GAAACACAGACTTGGCCACAAACAT
>probe:Drosophila_2:1638494_at:162:545; Interrogation_Position=586; Antisense; GGATCTACCACCCAAATGCATCAAG
>probe:Drosophila_2:1638494_at:79:233; Interrogation_Position=600; Antisense; AATGCATCAAGGACGTCTGACGGGC
>probe:Drosophila_2:1638494_at:118:617; Interrogation_Position=628; Antisense; TGCAATGCTGTGATGTCTGCGCCCT
>probe:Drosophila_2:1638494_at:474:519; Interrogation_Position=729; Antisense; GTGGCAATACAGTCAGCCTATGCAG
>probe:Drosophila_2:1638494_at:454:683; Interrogation_Position=747; Antisense; TATGCAGAGTCACCAGCCGCAGTAC
>probe:Drosophila_2:1638494_at:656:355; Interrogation_Position=810; Antisense; GCACTATCAGCAGCCGAGCCAGGGA
>probe:Drosophila_2:1638494_at:560:81; Interrogation_Position=830; Antisense; AGGGACACCAACAGGTCAACCGGAT
>probe:Drosophila_2:1638494_at:650:201; Interrogation_Position=847; Antisense; AACCGGATGAAGACCTCCTACGACG
>probe:Drosophila_2:1638494_at:246:561; Interrogation_Position=893; Antisense; GGAACGGTCTAAACGCACCATCGAT
>probe:Drosophila_2:1638494_at:518:1; Interrogation_Position=989; Antisense; ATTGGCGTTGACGAAACCCTTGAGC

Paste this into a BLAST search page for me
AACCCTTGAGCCCATCATTAGTTGTGTACTTTTGCATGATTGGTGTCTCTTATTTGTTCCAAGACTTCCCCTACGGAAACACAGACTTGGCCACAAACATGGATCTACCACCCAAATGCATCAAGAATGCATCAAGGACGTCTGACGGGCTGCAATGCTGTGATGTCTGCGCCCTGTGGCAATACAGTCAGCCTATGCAGTATGCAGAGTCACCAGCCGCAGTACGCACTATCAGCAGCCGAGCCAGGGAAGGGACACCAACAGGTCAACCGGATAACCGGATGAAGACCTCCTACGACGGGAACGGTCTAAACGCACCATCGATATTGGCGTTGACGAAACCCTTGAGC

Full Affymetrix probeset data:

Annotations for 1638494_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720