FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638495_at:

>probe:Drosophila_2:1638495_at:624:621; Interrogation_Position=1986; Antisense; TGCTGGCAGCTCTGACGACGATGGA
>probe:Drosophila_2:1638495_at:665:405; Interrogation_Position=2002; Antisense; GACGATGGACCCAGCACTTCAAAGG
>probe:Drosophila_2:1638495_at:521:169; Interrogation_Position=2022; Antisense; AAAGGCTCCTCGGTTGACTGCAAAG
>probe:Drosophila_2:1638495_at:299:171; Interrogation_Position=2223; Antisense; AAAGTTGATCCTACTCTGAGCACTG
>probe:Drosophila_2:1638495_at:102:609; Interrogation_Position=2239; Antisense; TGAGCACTGCTTCTTCTTGGGAATT
>probe:Drosophila_2:1638495_at:669:1; Interrogation_Position=2261; Antisense; ATTTTGCGGCCACATAAGTCGGTTC
>probe:Drosophila_2:1638495_at:539:471; Interrogation_Position=2282; Antisense; GTTCGGCTGCACATACTGGGTTCCT
>probe:Drosophila_2:1638495_at:401:597; Interrogation_Position=2343; Antisense; TGTAGGAGCCGATGCCCGGAAGTAT
>probe:Drosophila_2:1638495_at:263:481; Interrogation_Position=2364; Antisense; GTATAGCGATGCACTTTAGGGCCCC
>probe:Drosophila_2:1638495_at:63:471; Interrogation_Position=2419; Antisense; GTTCGTTGTCTTATCAGCAGGGTCC
>probe:Drosophila_2:1638495_at:348:79; Interrogation_Position=2437; Antisense; AGGGTCCTTGGTTGCTTCATTTGTC
>probe:Drosophila_2:1638495_at:524:471; Interrogation_Position=2469; Antisense; GTTCGACCTCATTCTCAGTGATTTT
>probe:Drosophila_2:1638495_at:327:461; Interrogation_Position=2488; Antisense; GATTTTGGCTACTTTACTGGTGGTG
>probe:Drosophila_2:1638495_at:203:263; Interrogation_Position=2515; Antisense; CAGTTCGCCGTTTTTTCTCTTGATG

Paste this into a BLAST search page for me
TGCTGGCAGCTCTGACGACGATGGAGACGATGGACCCAGCACTTCAAAGGAAAGGCTCCTCGGTTGACTGCAAAGAAAGTTGATCCTACTCTGAGCACTGTGAGCACTGCTTCTTCTTGGGAATTATTTTGCGGCCACATAAGTCGGTTCGTTCGGCTGCACATACTGGGTTCCTTGTAGGAGCCGATGCCCGGAAGTATGTATAGCGATGCACTTTAGGGCCCCGTTCGTTGTCTTATCAGCAGGGTCCAGGGTCCTTGGTTGCTTCATTTGTCGTTCGACCTCATTCTCAGTGATTTTGATTTTGGCTACTTTACTGGTGGTGCAGTTCGCCGTTTTTTCTCTTGATG

Full Affymetrix probeset data:

Annotations for 1638495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720