FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638500_at:

>probe:Drosophila_2:1638500_at:170:211; Interrogation_Position=1028; Antisense; AAGAAGGTACATCAGCAGCCGCGAC
>probe:Drosophila_2:1638500_at:557:677; Interrogation_Position=1083; Antisense; TAGAGATCGGTAGCAGCGGCATCAA
>probe:Drosophila_2:1638500_at:462:435; Interrogation_Position=1150; Antisense; GAGGATGAAGCTGCCGGCGAATATC
>probe:Drosophila_2:1638500_at:404:311; Interrogation_Position=1176; Antisense; GCCAGCGCAAAGTGAAAGCCCTCGA
>probe:Drosophila_2:1638500_at:239:427; Interrogation_Position=1214; Antisense; GAGTTTAAAGTTGATCCCGCTCCGC
>probe:Drosophila_2:1638500_at:273:471; Interrogation_Position=1278; Antisense; GTTCCGATATGGTATTGCTCTGCGA
>probe:Drosophila_2:1638500_at:313:683; Interrogation_Position=1317; Antisense; TATCCACCTGCGTCTACGAAATGGA
>probe:Drosophila_2:1638500_at:98:615; Interrogation_Position=1347; Antisense; TGAAGCACCAATACGAAGCCGCCTG
>probe:Drosophila_2:1638500_at:653:559; Interrogation_Position=1376; Antisense; GGAAAGACACTGAACATACCGCCCT
>probe:Drosophila_2:1638500_at:649:31; Interrogation_Position=1412; Antisense; ATCAAGACCGAAGCCCTGGACAATA
>probe:Drosophila_2:1638500_at:200:95; Interrogation_Position=1475; Antisense; AGATTCCCCAGACGCCGAAGTGTGT
>probe:Drosophila_2:1638500_at:554:573; Interrogation_Position=1502; Antisense; GGCGTGCTAATCATTGTAACCCGTT
>probe:Drosophila_2:1638500_at:75:477; Interrogation_Position=1524; Antisense; GTTTTCCACTGTCCATATTTGTGCA
>probe:Drosophila_2:1638500_at:132:689; Interrogation_Position=1539; Antisense; TATTTGTGCATTTGCGCTACTCCCA

Paste this into a BLAST search page for me
AAGAAGGTACATCAGCAGCCGCGACTAGAGATCGGTAGCAGCGGCATCAAGAGGATGAAGCTGCCGGCGAATATCGCCAGCGCAAAGTGAAAGCCCTCGAGAGTTTAAAGTTGATCCCGCTCCGCGTTCCGATATGGTATTGCTCTGCGATATCCACCTGCGTCTACGAAATGGATGAAGCACCAATACGAAGCCGCCTGGGAAAGACACTGAACATACCGCCCTATCAAGACCGAAGCCCTGGACAATAAGATTCCCCAGACGCCGAAGTGTGTGGCGTGCTAATCATTGTAACCCGTTGTTTTCCACTGTCCATATTTGTGCATATTTGTGCATTTGCGCTACTCCCA

Full Affymetrix probeset data:

Annotations for 1638500_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720