FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638501_at:

>probe:Drosophila_2:1638501_at:287:277; Interrogation_Position=411; Antisense; CTATGCGGCGCAATCCTTGAAGGAT
>probe:Drosophila_2:1638501_at:529:723; Interrogation_Position=427; Antisense; TTGAAGGATACTCAGGCCACCGTGG
>probe:Drosophila_2:1638501_at:582:557; Interrogation_Position=519; Antisense; GGACATCCAAGACGACATGGCTGAT
>probe:Drosophila_2:1638501_at:345:131; Interrogation_Position=617; Antisense; ACCTGCAGGCCGAGTTGGATGCTCT
>probe:Drosophila_2:1638501_at:466:463; Interrogation_Position=651; Antisense; GATTGCCTTGGACGATGACACCAGC
>probe:Drosophila_2:1638501_at:248:419; Interrogation_Position=725; Antisense; GAGCTGACAGCATCGTCCCTGGAAA
>probe:Drosophila_2:1638501_at:637:175; Interrogation_Position=761; Antisense; AAACGGATGAGTTCGGCTTGCCCAA
>probe:Drosophila_2:1638501_at:332:721; Interrogation_Position=778; Antisense; TTGCCCAAGATTCCGACATCGCTGA
>probe:Drosophila_2:1638501_at:59:401; Interrogation_Position=792; Antisense; GACATCGCTGAAGACCACATAGGCA
>probe:Drosophila_2:1638501_at:308:117; Interrogation_Position=832; Antisense; AGCTCTCATGTTTCCATTCTTTATC
>probe:Drosophila_2:1638501_at:427:379; Interrogation_Position=864; Antisense; GAACCTTGGGCACGCTTTGTATATT
>probe:Drosophila_2:1638501_at:169:65; Interrogation_Position=898; Antisense; ATGGAGCCATCAAAGATTCCCTCTC
>probe:Drosophila_2:1638501_at:412:217; Interrogation_Position=923; Antisense; AAGTCTCACTTTTGTAACCATTTGT
>probe:Drosophila_2:1638501_at:8:27; Interrogation_Position=959; Antisense; ATAGCCGTTTAGTTATCACGCCACA

Paste this into a BLAST search page for me
CTATGCGGCGCAATCCTTGAAGGATTTGAAGGATACTCAGGCCACCGTGGGGACATCCAAGACGACATGGCTGATACCTGCAGGCCGAGTTGGATGCTCTGATTGCCTTGGACGATGACACCAGCGAGCTGACAGCATCGTCCCTGGAAAAAACGGATGAGTTCGGCTTGCCCAATTGCCCAAGATTCCGACATCGCTGAGACATCGCTGAAGACCACATAGGCAAGCTCTCATGTTTCCATTCTTTATCGAACCTTGGGCACGCTTTGTATATTATGGAGCCATCAAAGATTCCCTCTCAAGTCTCACTTTTGTAACCATTTGTATAGCCGTTTAGTTATCACGCCACA

Full Affymetrix probeset data:

Annotations for 1638501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720