FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638503_at:

>probe:Drosophila_2:1638503_at:221:221; Interrogation_Position=1628; Antisense; AAGTGGATCAGCATTCTTTGCCGGC
>probe:Drosophila_2:1638503_at:347:431; Interrogation_Position=1675; Antisense; GAGTCCACCAGGTCGGAGACGATTT
>probe:Drosophila_2:1638503_at:346:409; Interrogation_Position=1692; Antisense; GACGATTTGGACCATGCCATCAGCA
>probe:Drosophila_2:1638503_at:159:501; Interrogation_Position=1722; Antisense; GTCGTCACAGCAACAGATGCCGTTT
>probe:Drosophila_2:1638503_at:578:47; Interrogation_Position=1738; Antisense; ATGCCGTTTGGTCTGTATCCTGTGC
>probe:Drosophila_2:1638503_at:322:285; Interrogation_Position=1757; Antisense; CTGTGCCACTATCGATGCCAAATCA
>probe:Drosophila_2:1638503_at:359:109; Interrogation_Position=1799; Antisense; AGAATCCTCAACAATTTCCTTGCCA
>probe:Drosophila_2:1638503_at:475:169; Interrogation_Position=1823; Antisense; AAATGGCTCCTTTTCAGCAGCAGCA
>probe:Drosophila_2:1638503_at:112:463; Interrogation_Position=1878; Antisense; GATTCAGTCTTGTAGAGCACCACCG
>probe:Drosophila_2:1638503_at:716:351; Interrogation_Position=1944; Antisense; GCAGCAGCGATTATCCTGTCAACAA
>probe:Drosophila_2:1638503_at:193:263; Interrogation_Position=2000; Antisense; CAGCCCAGTCCAATAAGTGTTCTCA
>probe:Drosophila_2:1638503_at:13:85; Interrogation_Position=2015; Antisense; AGTGTTCTCATTCTCCACAATTTTG
>probe:Drosophila_2:1638503_at:398:243; Interrogation_Position=2033; Antisense; AATTTTGTCCCAGTTGTTGTTGCCA
>probe:Drosophila_2:1638503_at:486:57; Interrogation_Position=2071; Antisense; ATGAGATTCATGATGCCCCGATGTT

Paste this into a BLAST search page for me
AAGTGGATCAGCATTCTTTGCCGGCGAGTCCACCAGGTCGGAGACGATTTGACGATTTGGACCATGCCATCAGCAGTCGTCACAGCAACAGATGCCGTTTATGCCGTTTGGTCTGTATCCTGTGCCTGTGCCACTATCGATGCCAAATCAAGAATCCTCAACAATTTCCTTGCCAAAATGGCTCCTTTTCAGCAGCAGCAGATTCAGTCTTGTAGAGCACCACCGGCAGCAGCGATTATCCTGTCAACAACAGCCCAGTCCAATAAGTGTTCTCAAGTGTTCTCATTCTCCACAATTTTGAATTTTGTCCCAGTTGTTGTTGCCAATGAGATTCATGATGCCCCGATGTT

Full Affymetrix probeset data:

Annotations for 1638503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720