Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638505_at:

>probe:Drosophila_2:1638505_at:239:625; Interrogation_Position=1388; Antisense; TGCCGCTGCTCTACAAGTAGATGCG
>probe:Drosophila_2:1638505_at:730:87; Interrogation_Position=1403; Antisense; AGTAGATGCGTAATCCGTATCGGTA
>probe:Drosophila_2:1638505_at:629:235; Interrogation_Position=1414; Antisense; AATCCGTATCGGTAGCCATGGCATT
>probe:Drosophila_2:1638505_at:54:127; Interrogation_Position=1427; Antisense; AGCCATGGCATTCATCGCGTCTTTA
>probe:Drosophila_2:1638505_at:11:299; Interrogation_Position=1442; Antisense; CGCGTCTTTACTTAATCATTCTCAA
>probe:Drosophila_2:1638505_at:710:587; Interrogation_Position=1561; Antisense; TAATTAGGCCCTCTTTCAAAACAGT
>probe:Drosophila_2:1638505_at:24:91; Interrogation_Position=1583; Antisense; AGTTTTCGAACTGCGATACGATTTC
>probe:Drosophila_2:1638505_at:377:457; Interrogation_Position=1597; Antisense; GATACGATTTCAATATGCTCTACTT
>probe:Drosophila_2:1638505_at:6:603; Interrogation_Position=1612; Antisense; TGCTCTACTTTTGATTTCGCCATAT
>probe:Drosophila_2:1638505_at:503:367; Interrogation_Position=1761; Antisense; GAAGTTCACTTTCCGTTCTTTGGCT
>probe:Drosophila_2:1638505_at:239:633; Interrogation_Position=1772; Antisense; TCCGTTCTTTGGCTCATTCTAAATT
>probe:Drosophila_2:1638505_at:470:459; Interrogation_Position=1830; Antisense; GATATTTTACCTACTCATTACTTTG
>probe:Drosophila_2:1638505_at:120:667; Interrogation_Position=1841; Antisense; TACTCATTACTTTGTGTCATCGAAT
>probe:Drosophila_2:1638505_at:487:495; Interrogation_Position=1856; Antisense; GTCATCGAATGTTTCTTTTTATGGT

Paste this into a BLAST search page for me
TGCCGCTGCTCTACAAGTAGATGCGAGTAGATGCGTAATCCGTATCGGTAAATCCGTATCGGTAGCCATGGCATTAGCCATGGCATTCATCGCGTCTTTACGCGTCTTTACTTAATCATTCTCAATAATTAGGCCCTCTTTCAAAACAGTAGTTTTCGAACTGCGATACGATTTCGATACGATTTCAATATGCTCTACTTTGCTCTACTTTTGATTTCGCCATATGAAGTTCACTTTCCGTTCTTTGGCTTCCGTTCTTTGGCTCATTCTAAATTGATATTTTACCTACTCATTACTTTGTACTCATTACTTTGTGTCATCGAATGTCATCGAATGTTTCTTTTTATGGT

Full Affymetrix probeset data:

Annotations for 1638505_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime