Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638506_at:

>probe:Drosophila_2:1638506_at:677:53; Interrogation_Position=349; Antisense; ATGCACTTTGTGGTTCGTCGGCGGC
>probe:Drosophila_2:1638506_at:455:399; Interrogation_Position=429; Antisense; GACAGAGATTGTGGTCCAGCCAGAA
>probe:Drosophila_2:1638506_at:688:211; Interrogation_Position=452; Antisense; AAGAAAGCCCCAAGGAGCCCAACTG
>probe:Drosophila_2:1638506_at:391:573; Interrogation_Position=476; Antisense; GGCTGCGTGGCCTCGGAATAATCGT
>probe:Drosophila_2:1638506_at:425:595; Interrogation_Position=566; Antisense; TGTGGTTCATGACCGGAGCCATTTC
>probe:Drosophila_2:1638506_at:683:15; Interrogation_Position=586; Antisense; ATTTCCGTCCACAAGCTTGTTCTGG
>probe:Drosophila_2:1638506_at:243:581; Interrogation_Position=608; Antisense; TGGCCTTCTGCATCGGCATGGAGAT
>probe:Drosophila_2:1638506_at:287:639; Interrogation_Position=689; Antisense; TCGTAACTCCGATTGGCGTGGGCAT
>probe:Drosophila_2:1638506_at:188:351; Interrogation_Position=721; Antisense; GCAGTTAGCGAATCTGCCGCGGCTA
>probe:Drosophila_2:1638506_at:543:653; Interrogation_Position=744; Antisense; TAATCAGCCCAGCACGGTATCAGGA
>probe:Drosophila_2:1638506_at:446:269; Interrogation_Position=798; Antisense; CATCTACGTGGTCTTCTTTGAAATT
>probe:Drosophila_2:1638506_at:64:729; Interrogation_Position=821; Antisense; TTGTGGCCAAAAACCATGCCGGCAT
>probe:Drosophila_2:1638506_at:27:29; Interrogation_Position=844; Antisense; ATACGCATTTTACTCTCGTCGATGG
>probe:Drosophila_2:1638506_at:359:463; Interrogation_Position=872; Antisense; GATTCGTCCTGATGTTTGGCCTCCA

Paste this into a BLAST search page for me
ATGCACTTTGTGGTTCGTCGGCGGCGACAGAGATTGTGGTCCAGCCAGAAAAGAAAGCCCCAAGGAGCCCAACTGGGCTGCGTGGCCTCGGAATAATCGTTGTGGTTCATGACCGGAGCCATTTCATTTCCGTCCACAAGCTTGTTCTGGTGGCCTTCTGCATCGGCATGGAGATTCGTAACTCCGATTGGCGTGGGCATGCAGTTAGCGAATCTGCCGCGGCTATAATCAGCCCAGCACGGTATCAGGACATCTACGTGGTCTTCTTTGAAATTTTGTGGCCAAAAACCATGCCGGCATATACGCATTTTACTCTCGTCGATGGGATTCGTCCTGATGTTTGGCCTCCA

Full Affymetrix probeset data:

Annotations for 1638506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime