FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638507_at:

>probe:Drosophila_2:1638507_at:577:209; Interrogation_Position=376; Antisense; AAGCAGACAGCTCAGGACCTCAAGG
>probe:Drosophila_2:1638507_at:612:555; Interrogation_Position=399; Antisense; GGACGCCTACGTCGAGGAGCTAAAA
>probe:Drosophila_2:1638507_at:348:547; Interrogation_Position=495; Antisense; GGATGACACGCTCTACCTTTTGGTA
>probe:Drosophila_2:1638507_at:361:207; Interrogation_Position=526; Antisense; AAGCTGGGCCAGCAGGAGCACCTCA
>probe:Drosophila_2:1638507_at:353:113; Interrogation_Position=542; Antisense; AGCACCTCATTCTACCGCAGGGAAA
>probe:Drosophila_2:1638507_at:555:425; Interrogation_Position=578; Antisense; GAGAGTCCATGCGTCAGACTGCAGA
>probe:Drosophila_2:1638507_at:537:119; Interrogation_Position=632; Antisense; AGCTGCAGGTTCTTTTCTACGGCAA
>probe:Drosophila_2:1638507_at:137:517; Interrogation_Position=664; Antisense; GTGGGCTTCCACAAATACAAGTATC
>probe:Drosophila_2:1638507_at:305:91; Interrogation_Position=683; Antisense; AGTATCCCAGAAACCAGCGGACGGA
>probe:Drosophila_2:1638507_at:522:419; Interrogation_Position=706; Antisense; GAGACTGTCGGAGCCAAGGTCTTCT
>probe:Drosophila_2:1638507_at:566:223; Interrogation_Position=721; Antisense; AAGGTCTTCTTCTACAGAGCATCCC
>probe:Drosophila_2:1638507_at:517:577; Interrogation_Position=754; Antisense; GGCCAGGTGCCCGAAAATCTGACCA
>probe:Drosophila_2:1638507_at:514:605; Interrogation_Position=773; Antisense; TGACCAAGTTCGAGTGGCTTCCCAA
>probe:Drosophila_2:1638507_at:710:239; Interrogation_Position=823; Antisense; AATACAGCCTATGCCCAAAGCGTTA

Paste this into a BLAST search page for me
AAGCAGACAGCTCAGGACCTCAAGGGGACGCCTACGTCGAGGAGCTAAAAGGATGACACGCTCTACCTTTTGGTAAAGCTGGGCCAGCAGGAGCACCTCAAGCACCTCATTCTACCGCAGGGAAAGAGAGTCCATGCGTCAGACTGCAGAAGCTGCAGGTTCTTTTCTACGGCAAGTGGGCTTCCACAAATACAAGTATCAGTATCCCAGAAACCAGCGGACGGAGAGACTGTCGGAGCCAAGGTCTTCTAAGGTCTTCTTCTACAGAGCATCCCGGCCAGGTGCCCGAAAATCTGACCATGACCAAGTTCGAGTGGCTTCCCAAAATACAGCCTATGCCCAAAGCGTTA

Full Affymetrix probeset data:

Annotations for 1638507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720