FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638508_at:

>probe:Drosophila_2:1638508_at:399:29; Interrogation_Position=1250; Antisense; ATACGGTGGATCAGCCCGCTTGTGA
>probe:Drosophila_2:1638508_at:278:511; Interrogation_Position=1271; Antisense; GTGAGGCTGGAATCGACAACTACAA
>probe:Drosophila_2:1638508_at:368:675; Interrogation_Position=1305; Antisense; TAGAGATCCTGAGCGAACTCCCATG
>probe:Drosophila_2:1638508_at:370:63; Interrogation_Position=1343; Antisense; ATGTGAATGCAGGATTCTCCTCCGC
>probe:Drosophila_2:1638508_at:638:273; Interrogation_Position=1376; Antisense; CTTGGTTGCCTGTCAATCCGAATTA
>probe:Drosophila_2:1638508_at:7:115; Interrogation_Position=1427; Antisense; AGCAGGCGAGGCGAAGTCATTACAA
>probe:Drosophila_2:1638508_at:480:215; Interrogation_Position=1450; Antisense; AAGATCTATCAGTCCCTTCTGAAGC
>probe:Drosophila_2:1638508_at:708:613; Interrogation_Position=1469; Antisense; TGAAGCTCAGACAACTGCCAGTTCT
>probe:Drosophila_2:1638508_at:495:375; Interrogation_Position=1494; Antisense; GAAGAACGGATCCTTTGTTCCAGAA
>probe:Drosophila_2:1638508_at:239:711; Interrogation_Position=1523; Antisense; TTAATCGCAGGGTCTTCGCTTTCAA
>probe:Drosophila_2:1638508_at:248:157; Interrogation_Position=1568; Antisense; ACACTCTGCTGACCATTGTGAACGT
>probe:Drosophila_2:1638508_at:184:383; Interrogation_Position=1587; Antisense; GAACGTGAGCAACCGCACTGAACTG
>probe:Drosophila_2:1638508_at:343:383; Interrogation_Position=1606; Antisense; GAACTGGTTGACATCGCGGACTTTA
>probe:Drosophila_2:1638508_at:303:321; Interrogation_Position=1638; Antisense; GCCCAATCGATTGAGTGTCCTTGTG

Paste this into a BLAST search page for me
ATACGGTGGATCAGCCCGCTTGTGAGTGAGGCTGGAATCGACAACTACAATAGAGATCCTGAGCGAACTCCCATGATGTGAATGCAGGATTCTCCTCCGCCTTGGTTGCCTGTCAATCCGAATTAAGCAGGCGAGGCGAAGTCATTACAAAAGATCTATCAGTCCCTTCTGAAGCTGAAGCTCAGACAACTGCCAGTTCTGAAGAACGGATCCTTTGTTCCAGAATTAATCGCAGGGTCTTCGCTTTCAAACACTCTGCTGACCATTGTGAACGTGAACGTGAGCAACCGCACTGAACTGGAACTGGTTGACATCGCGGACTTTAGCCCAATCGATTGAGTGTCCTTGTG

Full Affymetrix probeset data:

Annotations for 1638508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720