Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638509_at:

>probe:Drosophila_2:1638509_at:43:395; Interrogation_Position=1101; Antisense; GAAATGCCCACCGACTATATGTCTA
>probe:Drosophila_2:1638509_at:192:543; Interrogation_Position=1150; Antisense; GGATTCTGATGAGTCCCCAAGTCAA
>probe:Drosophila_2:1638509_at:339:109; Interrogation_Position=1217; Antisense; AGAAGCTGTCTGCATGGGCGACCAT
>probe:Drosophila_2:1638509_at:396:623; Interrogation_Position=1249; Antisense; TGCGGATCCCACAGCTATATCGAAG
>probe:Drosophila_2:1638509_at:273:425; Interrogation_Position=1280; Antisense; GAGAGCTTGGCGAACCTGGTGAACC
>probe:Drosophila_2:1638509_at:481:491; Interrogation_Position=1298; Antisense; GTGAACCAGGCGCTGAACGACGAAA
>probe:Drosophila_2:1638509_at:174:581; Interrogation_Position=1378; Antisense; GGCCAAGTCGCGCTATATCTTGATG
>probe:Drosophila_2:1638509_at:375:525; Interrogation_Position=1408; Antisense; GGGAACCACAAGTCCGTGCAAGGAA
>probe:Drosophila_2:1638509_at:686:211; Interrogation_Position=1431; Antisense; AAGACACCGACGAGGCAGGCGCTTT
>probe:Drosophila_2:1638509_at:197:709; Interrogation_Position=1534; Antisense; TTAACTTATGCCAGCTGAGCCAATA
>probe:Drosophila_2:1638509_at:38:311; Interrogation_Position=1552; Antisense; GCCAATAACTTGTACCGTGTGGTTT
>probe:Drosophila_2:1638509_at:409:487; Interrogation_Position=1585; Antisense; GTACCTGTTATGTTAAACGCGTCCA
>probe:Drosophila_2:1638509_at:193:175; Interrogation_Position=1599; Antisense; AAACGCGTCCAATACGAGCTATTTA
>probe:Drosophila_2:1638509_at:405:419; Interrogation_Position=1614; Antisense; GAGCTATTTATTTGTCACACCGCCA

Paste this into a BLAST search page for me
GAAATGCCCACCGACTATATGTCTAGGATTCTGATGAGTCCCCAAGTCAAAGAAGCTGTCTGCATGGGCGACCATTGCGGATCCCACAGCTATATCGAAGGAGAGCTTGGCGAACCTGGTGAACCGTGAACCAGGCGCTGAACGACGAAAGGCCAAGTCGCGCTATATCTTGATGGGGAACCACAAGTCCGTGCAAGGAAAAGACACCGACGAGGCAGGCGCTTTTTAACTTATGCCAGCTGAGCCAATAGCCAATAACTTGTACCGTGTGGTTTGTACCTGTTATGTTAAACGCGTCCAAAACGCGTCCAATACGAGCTATTTAGAGCTATTTATTTGTCACACCGCCA

Full Affymetrix probeset data:

Annotations for 1638509_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime