Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638510_at:

>probe:Drosophila_2:1638510_at:83:335; Interrogation_Position=2017; Antisense; GCTGCAACTGTAAGGGACTACGGCT
>probe:Drosophila_2:1638510_at:34:147; Interrogation_Position=2033; Antisense; ACTACGGCTGGTCCGAAGCCCGTGA
>probe:Drosophila_2:1638510_at:473:379; Interrogation_Position=2047; Antisense; GAAGCCCGTGAGAGTCAGCGAAATT
>probe:Drosophila_2:1638510_at:134:93; Interrogation_Position=2076; Antisense; AGTTTTTCCGCCAATGCCGTCACCT
>probe:Drosophila_2:1638510_at:358:279; Interrogation_Position=2099; Antisense; CTACACCCACAATAACGCCTAGTGA
>probe:Drosophila_2:1638510_at:343:363; Interrogation_Position=2122; Antisense; GAATATCAATACTCGAGGACTGCTC
>probe:Drosophila_2:1638510_at:636:437; Interrogation_Position=2136; Antisense; GAGGACTGCTCTTCCGCAGCAACAG
>probe:Drosophila_2:1638510_at:25:113; Interrogation_Position=2153; Antisense; AGCAACAGCCAACTATGCAGCCGGG
>probe:Drosophila_2:1638510_at:476:233; Interrogation_Position=2213; Antisense; AATCCTCACAGCCAATACACTAATG
>probe:Drosophila_2:1638510_at:521:171; Interrogation_Position=2285; Antisense; AAAGATCACCGCCAGTTGGGAAATT
>probe:Drosophila_2:1638510_at:500:703; Interrogation_Position=2389; Antisense; TTAGTCCTCCCTTTACTTATAATCG
>probe:Drosophila_2:1638510_at:693:89; Interrogation_Position=2422; Antisense; AGTAGTGTTTAGCTAGACATTCTTT
>probe:Drosophila_2:1638510_at:101:403; Interrogation_Position=2437; Antisense; GACATTCTTTAATCTGTGTAGCTCT
>probe:Drosophila_2:1638510_at:638:485; Interrogation_Position=2454; Antisense; GTAGCTCTAAGTTTCGTGGTTTTCA

Paste this into a BLAST search page for me
GCTGCAACTGTAAGGGACTACGGCTACTACGGCTGGTCCGAAGCCCGTGAGAAGCCCGTGAGAGTCAGCGAAATTAGTTTTTCCGCCAATGCCGTCACCTCTACACCCACAATAACGCCTAGTGAGAATATCAATACTCGAGGACTGCTCGAGGACTGCTCTTCCGCAGCAACAGAGCAACAGCCAACTATGCAGCCGGGAATCCTCACAGCCAATACACTAATGAAAGATCACCGCCAGTTGGGAAATTTTAGTCCTCCCTTTACTTATAATCGAGTAGTGTTTAGCTAGACATTCTTTGACATTCTTTAATCTGTGTAGCTCTGTAGCTCTAAGTTTCGTGGTTTTCA

Full Affymetrix probeset data:

Annotations for 1638510_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime