FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638511_at:

>probe:Drosophila_2:1638511_at:170:487; Interrogation_Position=1467; Antisense; GTAGCCGAATTGAGGTACCTGCATT
>probe:Drosophila_2:1638511_at:428:5; Interrogation_Position=1475; Antisense; ATTGAGGTACCTGCATTTGCTTGAC
>probe:Drosophila_2:1638511_at:605:345; Interrogation_Position=1487; Antisense; GCATTTGCTTGACATCGATTCTTAC
>probe:Drosophila_2:1638511_at:536:399; Interrogation_Position=1497; Antisense; GACATCGATTCTTACTACCAGTTTA
>probe:Drosophila_2:1638511_at:431:659; Interrogation_Position=1545; Antisense; TAAGCGATATTAGTTTAGCACCGAA
>probe:Drosophila_2:1638511_at:598:475; Interrogation_Position=1557; Antisense; GTTTAGCACCGAACCGACTAAGGCA
>probe:Drosophila_2:1638511_at:692:199; Interrogation_Position=1568; Antisense; AACCGACTAAGGCACTTCTATGTAA
>probe:Drosophila_2:1638511_at:180:7; Interrogation_Position=1606; Antisense; ATTGATCTATGCCTTGGCTCTGAGT
>probe:Drosophila_2:1638511_at:713:49; Interrogation_Position=1614; Antisense; ATGCCTTGGCTCTGAGTCCGTGTGG
>probe:Drosophila_2:1638511_at:426:285; Interrogation_Position=1625; Antisense; CTGAGTCCGTGTGGCGCCCACTTAA
>probe:Drosophila_2:1638511_at:36:577; Interrogation_Position=1637; Antisense; GGCGCCCACTTAATGCATCGTTGTA
>probe:Drosophila_2:1638511_at:322:233; Interrogation_Position=1648; Antisense; AATGCATCGTTGTACTCGCTATTTA
>probe:Drosophila_2:1638511_at:402:293; Interrogation_Position=1655; Antisense; CGTTGTACTCGCTATTTATTTTATT
>probe:Drosophila_2:1638511_at:404:665; Interrogation_Position=1683; Antisense; TACACAGCGTGTTTATTTTTATAAA

Paste this into a BLAST search page for me
GTAGCCGAATTGAGGTACCTGCATTATTGAGGTACCTGCATTTGCTTGACGCATTTGCTTGACATCGATTCTTACGACATCGATTCTTACTACCAGTTTATAAGCGATATTAGTTTAGCACCGAAGTTTAGCACCGAACCGACTAAGGCAAACCGACTAAGGCACTTCTATGTAAATTGATCTATGCCTTGGCTCTGAGTATGCCTTGGCTCTGAGTCCGTGTGGCTGAGTCCGTGTGGCGCCCACTTAAGGCGCCCACTTAATGCATCGTTGTAAATGCATCGTTGTACTCGCTATTTACGTTGTACTCGCTATTTATTTTATTTACACAGCGTGTTTATTTTTATAAA

Full Affymetrix probeset data:

Annotations for 1638511_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720