FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638512_at:

>probe:Drosophila_2:1638512_at:41:597; Interrogation_Position=3191; Antisense; TGTGCCGAGGCCAATTTGCCCGGAG
>probe:Drosophila_2:1638512_at:187:719; Interrogation_Position=3206; Antisense; TTGCCCGGAGTCTGTACGAGAATCT
>probe:Drosophila_2:1638512_at:625:291; Interrogation_Position=3222; Antisense; CGAGAATCTCCAAGTTTACGCCGTG
>probe:Drosophila_2:1638512_at:531:671; Interrogation_Position=3238; Antisense; TACGCCGTGGATACTGGAGCATGTC
>probe:Drosophila_2:1638512_at:583:409; Interrogation_Position=3284; Antisense; GACGACGGCAGATCTACTTTTGTTA
>probe:Drosophila_2:1638512_at:241:17; Interrogation_Position=3394; Antisense; ATTTTAACATCATGGCCTTGTGGGC
>probe:Drosophila_2:1638512_at:320:155; Interrogation_Position=3470; Antisense; ACAGTCAACGCCCACTAATTTAGTC
>probe:Drosophila_2:1638512_at:472:55; Interrogation_Position=3491; Antisense; AGTCTAGCGAAATGTTAGCACCGTA
>probe:Drosophila_2:1638512_at:547:675; Interrogation_Position=3506; Antisense; TAGCACCGTAAGTTGTCTAACAAGG
>probe:Drosophila_2:1638512_at:132:289; Interrogation_Position=3535; Antisense; CGGTCGGATTTCGAATGGGATTATC
>probe:Drosophila_2:1638512_at:506:527; Interrogation_Position=3611; Antisense; GGGAGTCATTTGCATGTCCACAAGT
>probe:Drosophila_2:1638512_at:218:53; Interrogation_Position=3697; Antisense; ATGCATGCAGACATCCGAACGTTGT
>probe:Drosophila_2:1638512_at:176:381; Interrogation_Position=3713; Antisense; GAACGTTGTTTGTATCTTGCCCAAA
>probe:Drosophila_2:1638512_at:195:89; Interrogation_Position=3743; Antisense; AGTCTATCTATAGCGATGCGAAAGC

Paste this into a BLAST search page for me
TGTGCCGAGGCCAATTTGCCCGGAGTTGCCCGGAGTCTGTACGAGAATCTCGAGAATCTCCAAGTTTACGCCGTGTACGCCGTGGATACTGGAGCATGTCGACGACGGCAGATCTACTTTTGTTAATTTTAACATCATGGCCTTGTGGGCACAGTCAACGCCCACTAATTTAGTCAGTCTAGCGAAATGTTAGCACCGTATAGCACCGTAAGTTGTCTAACAAGGCGGTCGGATTTCGAATGGGATTATCGGGAGTCATTTGCATGTCCACAAGTATGCATGCAGACATCCGAACGTTGTGAACGTTGTTTGTATCTTGCCCAAAAGTCTATCTATAGCGATGCGAAAGC

Full Affymetrix probeset data:

Annotations for 1638512_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720