FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638515_at:

>probe:Drosophila_2:1638515_at:474:625; Interrogation_Position=144; Antisense; TGCCACGGGTTGGTATGTTCCGGAT
>probe:Drosophila_2:1638515_at:550:519; Interrogation_Position=175; Antisense; GGAAAGTACCGGCACGATCCCAGGC
>probe:Drosophila_2:1638515_at:139:339; Interrogation_Position=212; Antisense; GCTATGGAGATCGTGGTGTTCCCTA
>probe:Drosophila_2:1638515_at:14:515; Interrogation_Position=227; Antisense; GTGTTCCCTATGACTCCGATTTGAG
>probe:Drosophila_2:1638515_at:562:77; Interrogation_Position=296; Antisense; AGGAGGCCGGTGAAGGTCTATCCCT
>probe:Drosophila_2:1638515_at:525:535; Interrogation_Position=322; Antisense; GGTCCACGAGATCATCTGCGATTCA
>probe:Drosophila_2:1638515_at:727:651; Interrogation_Position=357; Antisense; TAATTTCAATGGCACCGGCTGGCAG
>probe:Drosophila_2:1638515_at:251:441; Interrogation_Position=406; Antisense; GATGGCGATGAGTCCCATCCAGACA
>probe:Drosophila_2:1638515_at:298:681; Interrogation_Position=464; Antisense; TATGGGACTCGGATCAGGCCTATGC
>probe:Drosophila_2:1638515_at:268:293; Interrogation_Position=504; Antisense; CGATGGCTGCCATATCAACTGTCAG
>probe:Drosophila_2:1638515_at:240:339; Interrogation_Position=549; Antisense; GCTACAATCGGAGCCTGTCCAGGAG
>probe:Drosophila_2:1638515_at:648:73; Interrogation_Position=569; Antisense; AGGAGCCAGTGGTGCAGCCAACTCA
>probe:Drosophila_2:1638515_at:457:349; Interrogation_Position=630; Antisense; GCAGGATCCTGGCAAGATTCATGAT
>probe:Drosophila_2:1638515_at:143:233; Interrogation_Position=690; Antisense; AATCCTGCCTACGTTGCCAATTAAA

Paste this into a BLAST search page for me
TGCCACGGGTTGGTATGTTCCGGATGGAAAGTACCGGCACGATCCCAGGCGCTATGGAGATCGTGGTGTTCCCTAGTGTTCCCTATGACTCCGATTTGAGAGGAGGCCGGTGAAGGTCTATCCCTGGTCCACGAGATCATCTGCGATTCATAATTTCAATGGCACCGGCTGGCAGGATGGCGATGAGTCCCATCCAGACATATGGGACTCGGATCAGGCCTATGCCGATGGCTGCCATATCAACTGTCAGGCTACAATCGGAGCCTGTCCAGGAGAGGAGCCAGTGGTGCAGCCAACTCAGCAGGATCCTGGCAAGATTCATGATAATCCTGCCTACGTTGCCAATTAAA

Full Affymetrix probeset data:

Annotations for 1638515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720