Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638516_s_at:

>probe:Drosophila_2:1638516_s_at:618:391; Interrogation_Position=1001; Antisense; GAAAGGTCGGTAGGCCCAGAAGATC
>probe:Drosophila_2:1638516_s_at:326:683; Interrogation_Position=581; Antisense; TATACGCTTTGGACAGATACTGGCA
>probe:Drosophila_2:1638516_s_at:294:457; Interrogation_Position=596; Antisense; GATACTGGCACAATGGCTGCCTTAA
>probe:Drosophila_2:1638516_s_at:428:571; Interrogation_Position=610; Antisense; GGCTGCCTTAAATGTCACTGCTGTG
>probe:Drosophila_2:1638516_s_at:403:495; Interrogation_Position=623; Antisense; GTCACTGCTGTGGAGCTATGCTAGC
>probe:Drosophila_2:1638516_s_at:410:195; Interrogation_Position=650; Antisense; AAGTGGGTTCCAGCTGTTTTACGAG
>probe:Drosophila_2:1638516_s_at:412:71; Interrogation_Position=673; Antisense; AGGCGAGGCCTGATTCTTTGCAAAA
>probe:Drosophila_2:1638516_s_at:405:225; Interrogation_Position=697; Antisense; AAGGACTATTCCAGCATGTTCGGGT
>probe:Drosophila_2:1638516_s_at:106:619; Interrogation_Position=721; Antisense; TGCTCCGGAGTTTGTTCTGGCTGCG
>probe:Drosophila_2:1638516_s_at:516:551; Interrogation_Position=745; Antisense; GGAGAAACTATACCGCCAAGTGAAC
>probe:Drosophila_2:1638516_s_at:356:721; Interrogation_Position=837; Antisense; TTGCGTATTTCATCTAAGGTGCTTT
>probe:Drosophila_2:1638516_s_at:537:657; Interrogation_Position=870; Antisense; TAAGTGTGGATCCAGTCTGCGTCCT
>probe:Drosophila_2:1638516_s_at:64:679; Interrogation_Position=914; Antisense; TAGGAGCTAGCTTGGTGTGTGAACA
>probe:Drosophila_2:1638516_s_at:650:193; Interrogation_Position=970; Antisense; AACTCGAATGGAACGCTTGGACAAA

Paste this into a BLAST search page for me
GAAAGGTCGGTAGGCCCAGAAGATCTATACGCTTTGGACAGATACTGGCAGATACTGGCACAATGGCTGCCTTAAGGCTGCCTTAAATGTCACTGCTGTGGTCACTGCTGTGGAGCTATGCTAGCAAGTGGGTTCCAGCTGTTTTACGAGAGGCGAGGCCTGATTCTTTGCAAAAAAGGACTATTCCAGCATGTTCGGGTTGCTCCGGAGTTTGTTCTGGCTGCGGGAGAAACTATACCGCCAAGTGAACTTGCGTATTTCATCTAAGGTGCTTTTAAGTGTGGATCCAGTCTGCGTCCTTAGGAGCTAGCTTGGTGTGTGAACAAACTCGAATGGAACGCTTGGACAAA

Full Affymetrix probeset data:

Annotations for 1638516_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime