FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638517_at:

>probe:Drosophila_2:1638517_at:8:337; Interrogation_Position=1042; Antisense; GCTGCGTTGGGCGAGCAAACTAAAA
>probe:Drosophila_2:1638517_at:316:619; Interrogation_Position=1094; Antisense; TGCTCCCCGGCGATGTATCGAAGAA
>probe:Drosophila_2:1638517_at:465:377; Interrogation_Position=1116; Antisense; GAACTTAAAGGATTGCCGCCCGTGT
>probe:Drosophila_2:1638517_at:607:299; Interrogation_Position=1132; Antisense; CGCCCGTGTTGTTGTAGCTACTTTA
>probe:Drosophila_2:1638517_at:631:253; Interrogation_Position=1170; Antisense; CAACGCATTAGAAGAGCCGGCTCCA
>probe:Drosophila_2:1638517_at:351:571; Interrogation_Position=1217; Antisense; GGCTCACTAAGTGGTCCATTCGACG
>probe:Drosophila_2:1638517_at:89:169; Interrogation_Position=1277; Antisense; AAAGGATTGCCAGCCTAAGTGCCAA
>probe:Drosophila_2:1638517_at:160:361; Interrogation_Position=1331; Antisense; GCAAGCAATTCTTACGGCTCCCATT
>probe:Drosophila_2:1638517_at:189:347; Interrogation_Position=1358; Antisense; GCATCACATTTGTCCTTGCGAAGTG
>probe:Drosophila_2:1638517_at:641:551; Interrogation_Position=1403; Antisense; TGAACGGTTTTTCCAGTCGGCTTGC
>probe:Drosophila_2:1638517_at:693:499; Interrogation_Position=1418; Antisense; GTCGGCTTGCCACCTGTGGAAAAGT
>probe:Drosophila_2:1638517_at:707:543; Interrogation_Position=1474; Antisense; GGATATGCCATGTGGGTTCTCGCAG
>probe:Drosophila_2:1638517_at:201:529; Interrogation_Position=1487; Antisense; GGGTTCTCGCAGCATTTATGGTTGA
>probe:Drosophila_2:1638517_at:61:227; Interrogation_Position=978; Antisense; AATGGTCCGGGTTGCGAATCCGAAT

Paste this into a BLAST search page for me
GCTGCGTTGGGCGAGCAAACTAAAATGCTCCCCGGCGATGTATCGAAGAAGAACTTAAAGGATTGCCGCCCGTGTCGCCCGTGTTGTTGTAGCTACTTTACAACGCATTAGAAGAGCCGGCTCCAGGCTCACTAAGTGGTCCATTCGACGAAAGGATTGCCAGCCTAAGTGCCAAGCAAGCAATTCTTACGGCTCCCATTGCATCACATTTGTCCTTGCGAAGTGTGAACGGTTTTTCCAGTCGGCTTGCGTCGGCTTGCCACCTGTGGAAAAGTGGATATGCCATGTGGGTTCTCGCAGGGGTTCTCGCAGCATTTATGGTTGAAATGGTCCGGGTTGCGAATCCGAAT

Full Affymetrix probeset data:

Annotations for 1638517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720