FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638519_at:

>probe:Drosophila_2:1638519_at:566:527; Interrogation_Position=392; Antisense; GGGACAAGCACAGGCGTGCCATGTT
>probe:Drosophila_2:1638519_at:236:627; Interrogation_Position=408; Antisense; TGCCATGTTTGAGCGGCACATCGAG
>probe:Drosophila_2:1638519_at:236:227; Interrogation_Position=490; Antisense; AAGGCGCAATCGCATCATGGTCACT
>probe:Drosophila_2:1638519_at:105:631; Interrogation_Position=631; Antisense; TCCGTGGAGCGAGATGATCATCATC
>probe:Drosophila_2:1638519_at:698:453; Interrogation_Position=646; Antisense; GATCATCATCAACGTAGCCATCAGC
>probe:Drosophila_2:1638519_at:493:671; Interrogation_Position=678; Antisense; TACGCCGGACATTGGCGTGCATCGT
>probe:Drosophila_2:1638519_at:27:215; Interrogation_Position=712; Antisense; AAGAGGCCCAGTTTCCGGCAGAAGC
>probe:Drosophila_2:1638519_at:290:567; Interrogation_Position=728; Antisense; GGCAGAAGCTCTTCGGTCAGACCAT
>probe:Drosophila_2:1638519_at:614:307; Interrogation_Position=749; Antisense; CCATCGCCCATGTCAAACTGGTGGA
>probe:Drosophila_2:1638519_at:625:457; Interrogation_Position=784; Antisense; GATAGCACGGATTCAGCTGGCGCAT
>probe:Drosophila_2:1638519_at:674:39; Interrogation_Position=807; Antisense; ATCTGGTCCGGGTACGAGATCAGGT
>probe:Drosophila_2:1638519_at:619:95; Interrogation_Position=823; Antisense; AGATCAGGTCGCAGTACGGTCGCCA
>probe:Drosophila_2:1638519_at:454:45; Interrogation_Position=884; Antisense; ATCCCGGCGAGAAACGACAGCGACT
>probe:Drosophila_2:1638519_at:563:79; Interrogation_Position=938; Antisense; AGGTGGTGCGTGTCAGCTCGATTCC

Paste this into a BLAST search page for me
GGGACAAGCACAGGCGTGCCATGTTTGCCATGTTTGAGCGGCACATCGAGAAGGCGCAATCGCATCATGGTCACTTCCGTGGAGCGAGATGATCATCATCGATCATCATCAACGTAGCCATCAGCTACGCCGGACATTGGCGTGCATCGTAAGAGGCCCAGTTTCCGGCAGAAGCGGCAGAAGCTCTTCGGTCAGACCATCCATCGCCCATGTCAAACTGGTGGAGATAGCACGGATTCAGCTGGCGCATATCTGGTCCGGGTACGAGATCAGGTAGATCAGGTCGCAGTACGGTCGCCAATCCCGGCGAGAAACGACAGCGACTAGGTGGTGCGTGTCAGCTCGATTCC

Full Affymetrix probeset data:

Annotations for 1638519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720