Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638520_at:

>probe:Drosophila_2:1638520_at:371:475; Interrogation_Position=1411; Antisense; GTTACTTTAATGTTACTGTTCGCAT
>probe:Drosophila_2:1638520_at:620:273; Interrogation_Position=1433; Antisense; CATTAATTAAGTTTCTGCTGCCTCT
>probe:Drosophila_2:1638520_at:105:643; Interrogation_Position=1446; Antisense; TCTGCTGCCTCTTTATTTATTTGAA
>probe:Drosophila_2:1638520_at:577:403; Interrogation_Position=1478; Antisense; GACTTTGTATAAACCACTTGCGATA
>probe:Drosophila_2:1638520_at:106:93; Interrogation_Position=1519; Antisense; AGTTGATGTTGTTGTTTCGAGCCCA
>probe:Drosophila_2:1638520_at:260:417; Interrogation_Position=1537; Antisense; GAGCCCAACATATATAACATGCCTT
>probe:Drosophila_2:1638520_at:614:683; Interrogation_Position=1588; Antisense; TATAAGTACCCACTCGGTTCACTTT
>probe:Drosophila_2:1638520_at:266:403; Interrogation_Position=1614; Antisense; GACTTGAATTGTTAACTCGAACGCA
>probe:Drosophila_2:1638520_at:33:281; Interrogation_Position=1629; Antisense; CTCGAACGCAATTGTTTTGGCATAC
>probe:Drosophila_2:1638520_at:701:569; Interrogation_Position=1647; Antisense; GGCATACAATGTGTTTAGCGACTAA
>probe:Drosophila_2:1638520_at:189:121; Interrogation_Position=1699; Antisense; AGCGAAGAAGCTCTGTCCAAGTATT
>probe:Drosophila_2:1638520_at:410:481; Interrogation_Position=1719; Antisense; GTATTATACTTCAAGCGGACAACCA
>probe:Drosophila_2:1638520_at:608:321; Interrogation_Position=1733; Antisense; GCGGACAACCAATACTCGTAGCGTT
>probe:Drosophila_2:1638520_at:121:601; Interrogation_Position=1828; Antisense; TGTAACTATCCCCAGAGCTATTTTC

Paste this into a BLAST search page for me
GTTACTTTAATGTTACTGTTCGCATCATTAATTAAGTTTCTGCTGCCTCTTCTGCTGCCTCTTTATTTATTTGAAGACTTTGTATAAACCACTTGCGATAAGTTGATGTTGTTGTTTCGAGCCCAGAGCCCAACATATATAACATGCCTTTATAAGTACCCACTCGGTTCACTTTGACTTGAATTGTTAACTCGAACGCACTCGAACGCAATTGTTTTGGCATACGGCATACAATGTGTTTAGCGACTAAAGCGAAGAAGCTCTGTCCAAGTATTGTATTATACTTCAAGCGGACAACCAGCGGACAACCAATACTCGTAGCGTTTGTAACTATCCCCAGAGCTATTTTC

Full Affymetrix probeset data:

Annotations for 1638520_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime