Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638521_a_at:

>probe:Drosophila_2:1638521_a_at:480:41; Interrogation_Position=1717; Antisense; ATCGGCGACGAACTGCAGGGCTACT
>probe:Drosophila_2:1638521_a_at:27:83; Interrogation_Position=1733; Antisense; AGGGCTACTCGGGATCGGACATAAG
>probe:Drosophila_2:1638521_a_at:47:137; Interrogation_Position=1809; Antisense; ACGCACTCCCGATCAGATTAAGCAA
>probe:Drosophila_2:1638521_a_at:33:1; Interrogation_Position=1844; Antisense; AGGAGGTTGACCAGCCGATTACTTT
>probe:Drosophila_2:1638521_a_at:574:301; Interrogation_Position=1858; Antisense; CCGATTACTTTGCAGGACTTCCAGG
>probe:Drosophila_2:1638521_a_at:310:211; Interrogation_Position=1900; Antisense; AAGAAGTCCGTCTCTGCCGATGACG
>probe:Drosophila_2:1638521_a_at:150:409; Interrogation_Position=1921; Antisense; GACGTTGCCCGCTTCGAAAAGTGGA
>probe:Drosophila_2:1638521_a_at:76:105; Interrogation_Position=1952; Antisense; AATACGGGTCGTGCTAGTTGTACGG
>probe:Drosophila_2:1638521_a_at:23:59; Interrogation_Position=2001; Antisense; ATGATCGTATCCCATGTGTACTTCC
>probe:Drosophila_2:1638521_a_at:656:509; Interrogation_Position=2016; Antisense; GTGTACTTCCCGATCACAATTATTT
>probe:Drosophila_2:1638521_a_at:602:235; Interrogation_Position=2053; Antisense; AATCGTACTCGTTAGCCGTAATGTT
>probe:Drosophila_2:1638521_a_at:624:27; Interrogation_Position=2087; Antisense; ATACGCTTAATTGCTCAAGTGCCCC
>probe:Drosophila_2:1638521_a_at:86:117; Interrogation_Position=2118; Antisense; AGCATTGCTCCTCTATGTACGTGCA
>probe:Drosophila_2:1638521_a_at:730:291; Interrogation_Position=2137; Antisense; CGTGCACACGGTAATCTGATATCTT

Paste this into a BLAST search page for me
ATCGGCGACGAACTGCAGGGCTACTAGGGCTACTCGGGATCGGACATAAGACGCACTCCCGATCAGATTAAGCAAAGGAGGTTGACCAGCCGATTACTTTCCGATTACTTTGCAGGACTTCCAGGAAGAAGTCCGTCTCTGCCGATGACGGACGTTGCCCGCTTCGAAAAGTGGAAATACGGGTCGTGCTAGTTGTACGGATGATCGTATCCCATGTGTACTTCCGTGTACTTCCCGATCACAATTATTTAATCGTACTCGTTAGCCGTAATGTTATACGCTTAATTGCTCAAGTGCCCCAGCATTGCTCCTCTATGTACGTGCACGTGCACACGGTAATCTGATATCTT

Full Affymetrix probeset data:

Annotations for 1638521_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime