FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638522_at:

>probe:Drosophila_2:1638522_at:139:381; Interrogation_Position=466; Antisense; GAACCGGAGAAGCACACCATTGACT
>probe:Drosophila_2:1638522_at:210:7; Interrogation_Position=484; Antisense; ATTGACTACAAATTCGCCGACATGC
>probe:Drosophila_2:1638522_at:126:153; Interrogation_Position=503; Antisense; ACATGCTGGCACACACGCTGTGGGA
>probe:Drosophila_2:1638522_at:511:81; Interrogation_Position=536; Antisense; AGGTGGAGCACCTCATGTCCTGGCT
>probe:Drosophila_2:1638522_at:518:305; Interrogation_Position=588; Antisense; CCTTGGCGAGCAGTTCGAGCGATGT
>probe:Drosophila_2:1638522_at:426:177; Interrogation_Position=617; Antisense; AAACGGCTGGCAAGATTTCGCTGCA
>probe:Drosophila_2:1638522_at:503:95; Interrogation_Position=650; Antisense; AGATTGGCATGCGACTCGGTGATCC
>probe:Drosophila_2:1638522_at:349:359; Interrogation_Position=692; Antisense; GCAAGCTCTACTACAGCATTTCGCT
>probe:Drosophila_2:1638522_at:120:345; Interrogation_Position=707; Antisense; GCATTTCGCTAATCCAGCGTGGTCA
>probe:Drosophila_2:1638522_at:92:537; Interrogation_Position=727; Antisense; GGTCAACTACGGATGGCGAAGCATT
>probe:Drosophila_2:1638522_at:289:325; Interrogation_Position=742; Antisense; GCGAAGCATTTGATCCGACAGCAGT
>probe:Drosophila_2:1638522_at:203:727; Interrogation_Position=828; Antisense; TTGGCGGCGACTTAGCTACGAGTAC
>probe:Drosophila_2:1638522_at:689:465; Interrogation_Position=886; Antisense; GTTGGACTTGGAACCGCAGATTATT
>probe:Drosophila_2:1638522_at:125:81; Interrogation_Position=944; Antisense; AGGTGGTCACGATTCGAGCGTCGAT

Paste this into a BLAST search page for me
GAACCGGAGAAGCACACCATTGACTATTGACTACAAATTCGCCGACATGCACATGCTGGCACACACGCTGTGGGAAGGTGGAGCACCTCATGTCCTGGCTCCTTGGCGAGCAGTTCGAGCGATGTAAACGGCTGGCAAGATTTCGCTGCAAGATTGGCATGCGACTCGGTGATCCGCAAGCTCTACTACAGCATTTCGCTGCATTTCGCTAATCCAGCGTGGTCAGGTCAACTACGGATGGCGAAGCATTGCGAAGCATTTGATCCGACAGCAGTTTGGCGGCGACTTAGCTACGAGTACGTTGGACTTGGAACCGCAGATTATTAGGTGGTCACGATTCGAGCGTCGAT

Full Affymetrix probeset data:

Annotations for 1638522_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720