FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638523_at:

>probe:Drosophila_2:1638523_at:285:451; Interrogation_Position=1008; Antisense; GATCGACATCGAGCAACGTAACTGA
>probe:Drosophila_2:1638523_at:90:539; Interrogation_Position=1043; Antisense; GGTAATGCACCCAGTAATTCTAAAA
>probe:Drosophila_2:1638523_at:137:487; Interrogation_Position=1073; Antisense; GTACCCCTTTCATAGAGTTTTGGTG
>probe:Drosophila_2:1638523_at:611:363; Interrogation_Position=1150; Antisense; GAATTTCTTCTATATGCGGGCCTTA
>probe:Drosophila_2:1638523_at:607:329; Interrogation_Position=1165; Antisense; GCGGGCCTTATGTTATCACATCGGT
>probe:Drosophila_2:1638523_at:325:15; Interrogation_Position=1213; Antisense; ATTAGTTGGCCATAAATTTGCGTCA
>probe:Drosophila_2:1638523_at:39:33; Interrogation_Position=1247; Antisense; ATAATTAACCATTTGCCTTCGCCCA
>probe:Drosophila_2:1638523_at:22:633; Interrogation_Position=1265; Antisense; TCGCCCACTGACTTAACAAACACTG
>probe:Drosophila_2:1638523_at:520:515; Interrogation_Position=1328; Antisense; GTGTACATATATGCACTCGATGCTT
>probe:Drosophila_2:1638523_at:560:445; Interrogation_Position=1346; Antisense; GATGCTTTATAACTCGACCTTTCGT
>probe:Drosophila_2:1638523_at:116:293; Interrogation_Position=1359; Antisense; TCGACCTTTCGTCTGCCGAGGTAAA
>probe:Drosophila_2:1638523_at:553:11; Interrogation_Position=882; Antisense; ATTACGAGGTTCTGGTGAGGATCTA
>probe:Drosophila_2:1638523_at:377:545; Interrogation_Position=900; Antisense; GGATCTAGACGGACAGCTTTGCCTT
>probe:Drosophila_2:1638523_at:445:399; Interrogation_Position=911; Antisense; GACAGCTTTGCCTTTATTCCATTTT

Paste this into a BLAST search page for me
GATCGACATCGAGCAACGTAACTGAGGTAATGCACCCAGTAATTCTAAAAGTACCCCTTTCATAGAGTTTTGGTGGAATTTCTTCTATATGCGGGCCTTAGCGGGCCTTATGTTATCACATCGGTATTAGTTGGCCATAAATTTGCGTCAATAATTAACCATTTGCCTTCGCCCATCGCCCACTGACTTAACAAACACTGGTGTACATATATGCACTCGATGCTTGATGCTTTATAACTCGACCTTTCGTTCGACCTTTCGTCTGCCGAGGTAAAATTACGAGGTTCTGGTGAGGATCTAGGATCTAGACGGACAGCTTTGCCTTGACAGCTTTGCCTTTATTCCATTTT

Full Affymetrix probeset data:

Annotations for 1638523_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720