Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638524_s_at:

>probe:Drosophila_2:1638524_s_at:610:111; Interrogation_Position=106; Antisense; AGCACTATGAGGTCTGCCCCTTATT
>probe:Drosophila_2:1638524_s_at:368:625; Interrogation_Position=120; Antisense; TGCCCCTTATTGTCAGCCAAGTGGA
>probe:Drosophila_2:1638524_s_at:561:495; Interrogation_Position=131; Antisense; GTCAGCCAAGTGGAGGATATTGTAA
>probe:Drosophila_2:1638524_s_at:583:77; Interrogation_Position=144; Antisense; AGGATATTGTAAGTCGCATGCGGAT
>probe:Drosophila_2:1638524_s_at:527:219; Interrogation_Position=154; Antisense; AAGTCGCATGCGGATTGCTGCTCCA
>probe:Drosophila_2:1638524_s_at:447:705; Interrogation_Position=16; Antisense; TTGATAGCCCGACTGGCGTTTTTAG
>probe:Drosophila_2:1638524_s_at:318:465; Interrogation_Position=166; Antisense; GATTGCTGCTCCACGATGTGCCTGA
>probe:Drosophila_2:1638524_s_at:616:137; Interrogation_Position=178; Antisense; ACGATGTGCCTGACCCAACTGGGTC
>probe:Drosophila_2:1638524_s_at:517:253; Interrogation_Position=193; Antisense; CAACTGGGTCAGTGTTCACCCAAAA
>probe:Drosophila_2:1638524_s_at:145:319; Interrogation_Position=31; Antisense; GCGTTTTTAGTCTCTATTCTGGGCA
>probe:Drosophila_2:1638524_s_at:140:715; Interrogation_Position=47; Antisense; TTCTGGGCATTGTGGTTGGGTTCCA
>probe:Drosophila_2:1638524_s_at:170:531; Interrogation_Position=64; Antisense; GGGTTCCAGAAACTGGACTCCACTT
>probe:Drosophila_2:1638524_s_at:447:107; Interrogation_Position=71; Antisense; AGAAACTGGACTCCACTTCCAGTCC
>probe:Drosophila_2:1638524_s_at:268:137; Interrogation_Position=97; Antisense; ACGACTACCAGCACTATGAGGTCTG

Paste this into a BLAST search page for me
AGCACTATGAGGTCTGCCCCTTATTTGCCCCTTATTGTCAGCCAAGTGGAGTCAGCCAAGTGGAGGATATTGTAAAGGATATTGTAAGTCGCATGCGGATAAGTCGCATGCGGATTGCTGCTCCATTGATAGCCCGACTGGCGTTTTTAGGATTGCTGCTCCACGATGTGCCTGAACGATGTGCCTGACCCAACTGGGTCCAACTGGGTCAGTGTTCACCCAAAAGCGTTTTTAGTCTCTATTCTGGGCATTCTGGGCATTGTGGTTGGGTTCCAGGGTTCCAGAAACTGGACTCCACTTAGAAACTGGACTCCACTTCCAGTCCACGACTACCAGCACTATGAGGTCTG

Full Affymetrix probeset data:

Annotations for 1638524_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime