FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638525_at:

>probe:Drosophila_2:1638525_at:358:575; Interrogation_Position=1024; Antisense; GGCGATGCCGCTTACAACCAAAAGT
>probe:Drosophila_2:1638525_at:53:171; Interrogation_Position=1044; Antisense; AAAGTGGTTTCAGTGCAGCAAATCC
>probe:Drosophila_2:1638525_at:603:165; Interrogation_Position=1063; Antisense; AAATCCTATTGCACCATGTTGAAGT
>probe:Drosophila_2:1638525_at:20:437; Interrogation_Position=1098; Antisense; GAGGAGTCAGAAACCAGCTTCAATA
>probe:Drosophila_2:1638525_at:194:115; Interrogation_Position=1113; Antisense; AGCTTCAATAAGACCGCCGACTTTT
>probe:Drosophila_2:1638525_at:84:37; Interrogation_Position=632; Antisense; ATCTAGCGGGTATTGCTTTTCTCTG
>probe:Drosophila_2:1638525_at:627:451; Interrogation_Position=661; Antisense; GATCTTTTGCTCGTCGTAGTCATTA
>probe:Drosophila_2:1638525_at:382:499; Interrogation_Position=673; Antisense; GTCGTAGTCATTACCCAGATTTGTA
>probe:Drosophila_2:1638525_at:67:397; Interrogation_Position=799; Antisense; GACAAGTGCCTTAAACTATGCGAAC
>probe:Drosophila_2:1638525_at:80:483; Interrogation_Position=837; Antisense; GTATAGTTTCTCTTTGCTGCTTAAT
>probe:Drosophila_2:1638525_at:444:335; Interrogation_Position=852; Antisense; GCTGCTTAATTTCCTTATGGCATCC
>probe:Drosophila_2:1638525_at:11:69; Interrogation_Position=868; Antisense; ATGGCATCCATGCAGATTTGTTTCA
>probe:Drosophila_2:1638525_at:142:479; Interrogation_Position=887; Antisense; GTTTCATAGCCTTTCAGGTCACCGA
>probe:Drosophila_2:1638525_at:563:529; Interrogation_Position=992; Antisense; GGGATACTTTAATTGCCGCGAGCTT

Paste this into a BLAST search page for me
GGCGATGCCGCTTACAACCAAAAGTAAAGTGGTTTCAGTGCAGCAAATCCAAATCCTATTGCACCATGTTGAAGTGAGGAGTCAGAAACCAGCTTCAATAAGCTTCAATAAGACCGCCGACTTTTATCTAGCGGGTATTGCTTTTCTCTGGATCTTTTGCTCGTCGTAGTCATTAGTCGTAGTCATTACCCAGATTTGTAGACAAGTGCCTTAAACTATGCGAACGTATAGTTTCTCTTTGCTGCTTAATGCTGCTTAATTTCCTTATGGCATCCATGGCATCCATGCAGATTTGTTTCAGTTTCATAGCCTTTCAGGTCACCGAGGGATACTTTAATTGCCGCGAGCTT

Full Affymetrix probeset data:

Annotations for 1638525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720