Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638527_a_at:

>probe:Drosophila_2:1638527_a_at:644:713; Interrogation_Position=456; Antisense; TTCGTCGAAACAACAGTCAATCTGG
>probe:Drosophila_2:1638527_a_at:278:13; Interrogation_Position=491; Antisense; ATTACTCTTTGCGATACCATTTCCA
>probe:Drosophila_2:1638527_a_at:519:7; Interrogation_Position=536; Antisense; ATTGCTACTTTAAATGCGTCTTTTG
>probe:Drosophila_2:1638527_a_at:693:323; Interrogation_Position=551; Antisense; GCGTCTTTTGAACCAGACTACGATT
>probe:Drosophila_2:1638527_a_at:362:355; Interrogation_Position=584; Antisense; GCAAAGTCCCATGAATTTAGCAAAG
>probe:Drosophila_2:1638527_a_at:375:213; Interrogation_Position=606; Antisense; AAGAGCCGTCATTGCAGTGGGTTAT
>probe:Drosophila_2:1638527_a_at:243:517; Interrogation_Position=622; Antisense; GTGGGTTATGAACTCAATCCATGCA
>probe:Drosophila_2:1638527_a_at:254:257; Interrogation_Position=645; Antisense; CAAATTTATCGGCATTAGCGGGAGA
>probe:Drosophila_2:1638527_a_at:118:209; Interrogation_Position=678; Antisense; AAGCTATACGTCAACCATTATGGTC
>probe:Drosophila_2:1638527_a_at:198:469; Interrogation_Position=707; Antisense; GTTGACGACGAAGTGATCCTATCAG
>probe:Drosophila_2:1638527_a_at:507:625; Interrogation_Position=754; Antisense; TCCAGATCTAAGTTGCGATCCTTTT
>probe:Drosophila_2:1638527_a_at:103:49; Interrogation_Position=771; Antisense; ATCCTTTTGGCGAACCAGGCTGCTT
>probe:Drosophila_2:1638527_a_at:123:269; Interrogation_Position=786; Antisense; CAGGCTGCTTGTGGTCATTTAATTA
>probe:Drosophila_2:1638527_a_at:285:113; Interrogation_Position=859; Antisense; AGCAGTGAATTCTCTTTACGCCGGT

Paste this into a BLAST search page for me
TTCGTCGAAACAACAGTCAATCTGGATTACTCTTTGCGATACCATTTCCAATTGCTACTTTAAATGCGTCTTTTGGCGTCTTTTGAACCAGACTACGATTGCAAAGTCCCATGAATTTAGCAAAGAAGAGCCGTCATTGCAGTGGGTTATGTGGGTTATGAACTCAATCCATGCACAAATTTATCGGCATTAGCGGGAGAAAGCTATACGTCAACCATTATGGTCGTTGACGACGAAGTGATCCTATCAGTCCAGATCTAAGTTGCGATCCTTTTATCCTTTTGGCGAACCAGGCTGCTTCAGGCTGCTTGTGGTCATTTAATTAAGCAGTGAATTCTCTTTACGCCGGT

Full Affymetrix probeset data:

Annotations for 1638527_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime