FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638528_at:

>probe:Drosophila_2:1638528_at:634:497; Interrogation_Position=422; Antisense; GTCTTCTGAAGTACTCGCCACAGCA
>probe:Drosophila_2:1638528_at:690:83; Interrogation_Position=487; Antisense; AGTGATCCTGTGGTCATGTTTCAGA
>probe:Drosophila_2:1638528_at:372:375; Interrogation_Position=510; Antisense; GAAGAGATTCTATGTCCTGCTGTAC
>probe:Drosophila_2:1638528_at:719:151; Interrogation_Position=533; Antisense; ACATCTTCCTAAACGTACTGCTATC
>probe:Drosophila_2:1638528_at:618:669; Interrogation_Position=548; Antisense; TACTGCTATCGGTGAACACTCCGTT
>probe:Drosophila_2:1638528_at:466:573; Interrogation_Position=620; Antisense; GGCTGCGCAGTCTGATCGTTATCAA
>probe:Drosophila_2:1638528_at:667:473; Interrogation_Position=658; Antisense; GTTCACTCATCCCACTTTATTTGGA
>probe:Drosophila_2:1638528_at:529:131; Interrogation_Position=706; Antisense; ACCGATTCCAACAGTATCTTCCTGA
>probe:Drosophila_2:1638528_at:318:455; Interrogation_Position=729; Antisense; GATCACAAAGAGTTACTGGCCGCAG
>probe:Drosophila_2:1638528_at:580:89; Interrogation_Position=791; Antisense; AGTACGGCAACTATGCCTCTGGCAT
>probe:Drosophila_2:1638528_at:296:3; Interrogation_Position=814; Antisense; ATTGGGTCTTCCATGATCCGCGTGT
>probe:Drosophila_2:1638528_at:91:613; Interrogation_Position=866; Antisense; TGAAGACCATTGGATCCGTGGCCGT
>probe:Drosophila_2:1638528_at:2:589; Interrogation_Position=914; Antisense; TGGAGACTGGTCGTCCGATCGTCGA
>probe:Drosophila_2:1638528_at:150:231; Interrogation_Position=984; Antisense; CAACCATTTCCTCAACCGGGAGAAG

Paste this into a BLAST search page for me
GTCTTCTGAAGTACTCGCCACAGCAAGTGATCCTGTGGTCATGTTTCAGAGAAGAGATTCTATGTCCTGCTGTACACATCTTCCTAAACGTACTGCTATCTACTGCTATCGGTGAACACTCCGTTGGCTGCGCAGTCTGATCGTTATCAAGTTCACTCATCCCACTTTATTTGGAACCGATTCCAACAGTATCTTCCTGAGATCACAAAGAGTTACTGGCCGCAGAGTACGGCAACTATGCCTCTGGCATATTGGGTCTTCCATGATCCGCGTGTTGAAGACCATTGGATCCGTGGCCGTTGGAGACTGGTCGTCCGATCGTCGACAACCATTTCCTCAACCGGGAGAAG

Full Affymetrix probeset data:

Annotations for 1638528_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720