FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638529_at:

>probe:Drosophila_2:1638529_at:447:549; Interrogation_Position=1017; Antisense; GGAGGTGCCAACGACAAGATCGCCG
>probe:Drosophila_2:1638529_at:28:423; Interrogation_Position=1047; Antisense; GAGAAGGCCGGCGTCATTGTGACCA
>probe:Drosophila_2:1638529_at:65:169; Interrogation_Position=1084; Antisense; AAATGGGCCACGAGCTCTTCAAGGA
>probe:Drosophila_2:1638529_at:271:131; Interrogation_Position=1155; Antisense; ACCGGAATCCGTACGCCGATCAAAG
>probe:Drosophila_2:1638529_at:117:207; Interrogation_Position=1177; Antisense; AAGCGTATACGCAAACTCATGATGA
>probe:Drosophila_2:1638529_at:556:657; Interrogation_Position=1328; Antisense; TAAGTTAACTACTGCCGTACCACCA
>probe:Drosophila_2:1638529_at:679:281; Interrogation_Position=1339; Antisense; CTGCCGTACCACCAAGTTGAACTAA
>probe:Drosophila_2:1638529_at:302:247; Interrogation_Position=1392; Antisense; AATTGTTATTGCACTCGGCTCATTG
>probe:Drosophila_2:1638529_at:278:289; Interrogation_Position=1407; Antisense; CGGCTCATTGTTTGTGTTGCGAACA
>probe:Drosophila_2:1638529_at:437:469; Interrogation_Position=1422; Antisense; GTTGCGAACAGATTTTTGCCTTAAT
>probe:Drosophila_2:1638529_at:50:235; Interrogation_Position=1451; Antisense; AATGCCTGCTCGAATTATCAATGCG
>probe:Drosophila_2:1638529_at:417:599; Interrogation_Position=935; Antisense; TGTCGTCTCGTTCATTGCCGGAGTG
>probe:Drosophila_2:1638529_at:377:501; Interrogation_Position=976; Antisense; GTCGCATGGGTCACGCTGGAGCCAT
>probe:Drosophila_2:1638529_at:314:333; Interrogation_Position=990; Antisense; GCTGGAGCCATCATTTCCGGAGGAA

Paste this into a BLAST search page for me
GGAGGTGCCAACGACAAGATCGCCGGAGAAGGCCGGCGTCATTGTGACCAAAATGGGCCACGAGCTCTTCAAGGAACCGGAATCCGTACGCCGATCAAAGAAGCGTATACGCAAACTCATGATGATAAGTTAACTACTGCCGTACCACCACTGCCGTACCACCAAGTTGAACTAAAATTGTTATTGCACTCGGCTCATTGCGGCTCATTGTTTGTGTTGCGAACAGTTGCGAACAGATTTTTGCCTTAATAATGCCTGCTCGAATTATCAATGCGTGTCGTCTCGTTCATTGCCGGAGTGGTCGCATGGGTCACGCTGGAGCCATGCTGGAGCCATCATTTCCGGAGGAA

Full Affymetrix probeset data:

Annotations for 1638529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720