FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638532_at:

>probe:Drosophila_2:1638532_at:398:185; Interrogation_Position=304; Antisense; AAAATTTGGATACTCACTGCCCACC
>probe:Drosophila_2:1638532_at:255:259; Interrogation_Position=328; Antisense; CACTGCTTTTTTGGACCACCTGAAA
>probe:Drosophila_2:1638532_at:202:171; Interrogation_Position=351; Antisense; AAAGTACACCGTGCGAGTGGGCTCG
>probe:Drosophila_2:1638532_at:336:435; Interrogation_Position=389; Antisense; GAGGTGGTCAACTGCGTCATGTGAA
>probe:Drosophila_2:1638532_at:568:165; Interrogation_Position=416; Antisense; AAATCGTGGCGTTGGCGGCCTACAA
>probe:Drosophila_2:1638532_at:517:51; Interrogation_Position=451; Antisense; ATGCGACACGATCTGGCCATGATGA
>probe:Drosophila_2:1638532_at:561:233; Interrogation_Position=482; Antisense; AATCCCCGGTCTACTTTGGCAAATG
>probe:Drosophila_2:1638532_at:479:61; Interrogation_Position=504; Antisense; ATGTGTTAGGCCTGTGAAGCTACCC
>probe:Drosophila_2:1638532_at:559:481; Interrogation_Position=578; Antisense; GTATTACCTCGGCTAATGCGCAGAA
>probe:Drosophila_2:1638532_at:443:275; Interrogation_Position=616; Antisense; CTTCGCCGCGTGCAAATTGACTATA
>probe:Drosophila_2:1638532_at:648:223; Interrogation_Position=694; Antisense; AAGGACATGATCTGCGCCAGTCGAA
>probe:Drosophila_2:1638532_at:163:115; Interrogation_Position=730; Antisense; AGCTGTTCCGGAGATTCTGGTGGTC
>probe:Drosophila_2:1638532_at:446:623; Interrogation_Position=805; Antisense; TGCGCCAACAAAAACTATCCCGGTG
>probe:Drosophila_2:1638532_at:106:47; Interrogation_Position=821; Antisense; ATCCCGGTGTTTATGTCAACTGCAA

Paste this into a BLAST search page for me
AAAATTTGGATACTCACTGCCCACCCACTGCTTTTTTGGACCACCTGAAAAAAGTACACCGTGCGAGTGGGCTCGGAGGTGGTCAACTGCGTCATGTGAAAAATCGTGGCGTTGGCGGCCTACAAATGCGACACGATCTGGCCATGATGAAATCCCCGGTCTACTTTGGCAAATGATGTGTTAGGCCTGTGAAGCTACCCGTATTACCTCGGCTAATGCGCAGAACTTCGCCGCGTGCAAATTGACTATAAAGGACATGATCTGCGCCAGTCGAAAGCTGTTCCGGAGATTCTGGTGGTCTGCGCCAACAAAAACTATCCCGGTGATCCCGGTGTTTATGTCAACTGCAA

Full Affymetrix probeset data:

Annotations for 1638532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720